Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-607 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-607 Accession Number: MIMAT0003275 Mature Sequence: GUUCAAAUCCAGAUCUAUAAC hsa-miR-607 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-607 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-607 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Mouse Hmga2 (NM_010441) AAV Particle
MR221841A1V 250 µL

Mouse Hmga2 (NM_010441) AAV Particle

Sign In for Pricing
View Details
Beclin 1 Rabbit Monoclonal Antibody [KD Validation]
E51K63216 40 µL

Beclin 1 Rabbit Monoclonal Antibody [KD Validation]

Sign In for Pricing
View Details
UBE2N (Ubiquitin-conjugating Enzyme E2 N, Bendless-like Ubiquitin-conjugating Enzyme, BLU, Ubc13, UbcH13, Ubiquitin Carrier Protein N, Ubiquitin-protein Ligase N, UbcH-ben) (AP)
MBS6134425-01 0.1 mL

UBE2N (Ubiquitin-conjugating Enzyme E2 N, Bendless-like Ubiquitin-conjugating Enzyme, BLU, Ubc13, UbcH13, Ubiquitin Carrier Protein N, Ubiquitin-protein Ligase N, UbcH-ben) (AP)

Sign In for Pricing
View Details
UBE2N (Ubiquitin-conjugating Enzyme E2 N, Bendless-like Ubiquitin-conjugating Enzyme, BLU, Ubc13, UbcH13, Ubiquitin Carrier Protein N, Ubiquitin-protein Ligase N, UbcH-ben) (AP)
MBS6134425-02 5x 0.1 mL

UBE2N (Ubiquitin-conjugating Enzyme E2 N, Bendless-like Ubiquitin-conjugating Enzyme, BLU, Ubc13, UbcH13, Ubiquitin Carrier Protein N, Ubiquitin-protein Ligase N, UbcH-ben) (AP)

Sign In for Pricing
View Details
PHF6 Antibody / PHD finger protein 6
RQ8782 100 µg

PHF6 Antibody / PHD finger protein 6

Sign In for Pricing
View Details
Ccdc47 Rat Pre-designed siRNA Set A
HY-RS27043 1 Set

Ccdc47 Rat Pre-designed siRNA Set A

Sign In for Pricing
View Details