Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-5095 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-5095 Accession Number: MIMAT0020600 Mature Sequence: UUACAGGCGUGAACCACCGCG hsa-miR-5095 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-5095 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-5095 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

BCAS4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0173908 1.0 µg DNA

BCAS4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

Sign In for Pricing
View Details
Biotinylated Anti-CD40 (iscalimab biosimilar) mAb
E33B100020B 50 µg

Biotinylated Anti-CD40 (iscalimab biosimilar) mAb

Sign In for Pricing
View Details
Nsg2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3650508 1.0 µg DNA

Nsg2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

Sign In for Pricing
View Details
Kcnc1 (NM_001112739) Mouse Tagged Lenti ORF Clone
MR225888L4 10 µg

Kcnc1 (NM_001112739) Mouse Tagged Lenti ORF Clone

Sign In for Pricing
View Details
Rat Tex22 Pre-designed siRNA Set A
SI214404A 1 Each

Rat Tex22 Pre-designed siRNA Set A

Sign In for Pricing
View Details
BRD3 Antibody, Biotin conjugated
A55983-50UG 50 µg

BRD3 Antibody, Biotin conjugated

Sign In for Pricing
View Details