Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4502 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4502 Accession Number: MIMAT0019038 Mature Sequence: GCUGAUGAUGAUGGUGCUGAAG hsa-miR-4502 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4502 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4502 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

Nori® Bovine 2-Plex ELISA Kits-TGFb1/IL12
GR228118 96 Well

Nori® Bovine 2-Plex ELISA Kits-TGFb1/IL12

Ask
View Details
2B4/CD244/SLAMF4 hFc Chimera, Human
Z04975-100 100 µg

2B4/CD244/SLAMF4 hFc Chimera, Human

Ask
View Details
Biotinylated Anti-PD-1 (enlonstobart biosimilar) mAb
12-90139B-100 100 µg

Biotinylated Anti-PD-1 (enlonstobart biosimilar) mAb

Ask
View Details
pCR4-TOPO-TRPV3 Plasmid
PVT24439 2 µg

pCR4-TOPO-TRPV3 Plasmid

Ask
View Details
MPZ antibody (biotin)
MBS5310268-01 0.1 mg

MPZ antibody (biotin)

Ask
View Details
MPZ antibody (biotin)
MBS5310268-02 5x 0.1 mg

MPZ antibody (biotin)

Ask
View Details