Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4270 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4270 Accession Number: MIMAT0016900 Mature Sequence: UCAGGGAGUCAGGGGAGGGC hsa-miR-4270 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4270 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4270 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

AARD Human Over-expression Lysate
orb1343077 100 µg

AARD Human Over-expression Lysate

Sign In for Pricing
View Details
Signaling Lymphocytic Activation Molecule Family, Member 7 (SLAMF7) Antibody
abx122207-01 100 µg

Signaling Lymphocytic Activation Molecule Family, Member 7 (SLAMF7) Antibody

Sign In for Pricing
View Details
Signaling Lymphocytic Activation Molecule Family, Member 7 (SLAMF7) Antibody
abx122207-02 1 mg

Signaling Lymphocytic Activation Molecule Family, Member 7 (SLAMF7) Antibody

Sign In for Pricing
View Details
Gerfelin
HY-124723 1 Each

Gerfelin

Sign In for Pricing
View Details
Mouse ADP Ribosylation Factor-Like 2 Binding Protein (ARL2BP) ELISA Kit
abx388536 96 Tests

Mouse ADP Ribosylation Factor-Like 2 Binding Protein (ARL2BP) ELISA Kit

Sign In for Pricing
View Details
Mobiluncus curtisii (M. curtisii) (MaxLight 405) discontinued
M4100-40-ML405 100 µL

Mobiluncus curtisii (M. curtisii) (MaxLight 405) discontinued

Sign In for Pricing
View Details