Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-7844-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-7844-5p Accession Number: MIMAT0030419 Mature Sequence: AAAACUAGGACUGUGUGGUGUA hsa-miR-7844-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-7844-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-7844-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

P Glycoprotein (ABCB1) Mouse Monoclonal Antibody (HRP conjugated) [Clone ID: OTI2G4]
TA800919BM 100 µL

P Glycoprotein (ABCB1) Mouse Monoclonal Antibody (HRP conjugated) [Clone ID: OTI2G4]

Sign In for Pricing
View Details
Dehydroabietal
TRC-D229098-5MG 5 mg

Dehydroabietal

Sign In for Pricing
View Details
Amplite® Fluorimetric Total Thiol Quantitation Assay Kit *Green Fluorescence*
5524-AAT 200 Tests

Amplite® Fluorimetric Total Thiol Quantitation Assay Kit *Green Fluorescence*

Sign In for Pricing
View Details
RABL4 (IFT27) Rabbit Polyclonal Antibody
TA366144 100 µL

RABL4 (IFT27) Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
DDX4 Mouse Monoclonal Antibody [Clone ID: OTI2H9]
CF813383 100 µg

DDX4 Mouse Monoclonal Antibody [Clone ID: OTI2H9]

Sign In for Pricing
View Details
P62 Dok (Ab-362) Antibody
8B7057-AAT 50 µg

P62 Dok (Ab-362) Antibody

Sign In for Pricing
View Details