Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-5692b miRNA Agomir/Antagomir

MicroRNA: hsa-miR-5692b Accession Number: MIMAT0022497 Mature Sequence: AAUAAUAUCACAGUAGGUGU hsa-miR-5692b are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-5692b in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-5692b miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Monkey Small heterodimer partner ELISA kit
GTR10375237 96 Well

Monkey Small heterodimer partner ELISA kit

Sign In for Pricing
View Details
GC Agar (Powder)
G2023 500 g

GC Agar (Powder)

Sign In for Pricing
View Details
Phospho-Cytokeratin 17 (Ser44) Polyclonal Antibody, PerCP-Cy5.5 Conjugated
bs-3239R-PerCP-Cy5.5 100 µL

Phospho-Cytokeratin 17 (Ser44) Polyclonal Antibody, PerCP-Cy5.5 Conjugated

Sign In for Pricing
View Details
RNF139 Mouse Monoclonal Antibody
AMM83234-01 1 Each

RNF139 Mouse Monoclonal Antibody

Sign In for Pricing
View Details
RNF139 Mouse Monoclonal Antibody
AMM83234-02 50 µL

RNF139 Mouse Monoclonal Antibody

Sign In for Pricing
View Details
RNF139 Mouse Monoclonal Antibody
AMM83234-03 100 µL

RNF139 Mouse Monoclonal Antibody

Sign In for Pricing
View Details