Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-548m miRNA Agomir/Antagomir

MicroRNA: hsa-miR-548m Accession Number: MIMAT0005917 Mature Sequence: CAAAGGUAUUUGUGGUUUUUG hsa-miR-548m are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-548m in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-548m miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

EcoSpin PCR Purification Micro Kit
E2525 50 Reactions

EcoSpin PCR Purification Micro Kit

Sign In for Pricing
View Details
PFKP Knockout 786-O Polyclonal Cells
ARG5691 1 Million

PFKP Knockout 786-O Polyclonal Cells

Sign In for Pricing
View Details
BMPR1APS2 Protein Vector (Human) (pPM-C-His)
PV064768 500 ng

BMPR1APS2 Protein Vector (Human) (pPM-C-His)

Sign In for Pricing
View Details
ATP6AP1L (NM_001017971) Human Tagged Lenti ORF Clone
RC210900L3 10 µg

ATP6AP1L (NM_001017971) Human Tagged Lenti ORF Clone

Sign In for Pricing
View Details
Porcine Family With Sequence Similarity 132, Member A ELISA Kit
MBS056025-01 48 Well

Porcine Family With Sequence Similarity 132, Member A ELISA Kit

Sign In for Pricing
View Details
Porcine Family With Sequence Similarity 132, Member A ELISA Kit
MBS056025-02 96 Well

Porcine Family With Sequence Similarity 132, Member A ELISA Kit

Sign In for Pricing
View Details