Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-938 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-938 Accession Number: MIMAT0004981 Mature Sequence: UGCCCUUAAAGGUGAACCCAGU hsa-miR-938 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-938 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-938 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Calponin Recombinant Rabbit Monoclonal Antibody [SI67-01]
ET1606-17 100 µL

Calponin Recombinant Rabbit Monoclonal Antibody [SI67-01]

Sign In for Pricing
View Details
KCC2 (SLC12A5) (NM_020708) Human Over-expression Lysate
LC402800 20 µg

KCC2 (SLC12A5) (NM_020708) Human Over-expression Lysate

Sign In for Pricing
View Details
Plasma/Serum Exosome Purification and RNA Isolation Midi Kit
58500 25 Preparations

Plasma/Serum Exosome Purification and RNA Isolation Midi Kit

Sign In for Pricing
View Details
TFIIB (GTF2B) Mouse Monoclonal Antibody [Clone ID: OTI5B6]
CF808602 100 µg

TFIIB (GTF2B) Mouse Monoclonal Antibody [Clone ID: OTI5B6]

Sign In for Pricing
View Details
CD63 (Late Endosomes Marker) (LAMP3/2881), CF594 conjugate, 0.1mg/mL
BNC942881-100 1x 100 µL

CD63 (Late Endosomes Marker) (LAMP3/2881), CF594 conjugate, 0.1mg/mL

Sign In for Pricing
View Details
IL10 Mouse Monoclonal Antibody [Clone ID: 3C12C12]
AM06081PU-N 100 µL

IL10 Mouse Monoclonal Antibody [Clone ID: 3C12C12]

Sign In for Pricing
View Details