Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-711 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-711 Accession Number: MIMAT0012734 Mature Sequence: GGGACCCAGGGAGAGACGUAAG hsa-miR-711 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-711 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-711 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Sarm1 (NM_001168521) Mouse Tagged ORF Clone
MR216854 10 µg

Sarm1 (NM_001168521) Mouse Tagged ORF Clone

Sign In for Pricing
View Details
SLC26A1 (NM_134425) Human Tagged ORF Clone
RG224315 10 µg

SLC26A1 (NM_134425) Human Tagged ORF Clone

Sign In for Pricing
View Details
ZNF442 3'UTR Luciferase Stable Cell Line
TU029179 1.0 mL

ZNF442 3'UTR Luciferase Stable Cell Line

Sign In for Pricing
View Details
AGFG2 (NM_006076) Human Over-expression Lysate
LC401830 20 µg

AGFG2 (NM_006076) Human Over-expression Lysate

Sign In for Pricing
View Details
FRAXD Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV726192 1.0 µg DNA

FRAXD Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

Sign In for Pricing
View Details
Sheep Cyclin-G1 (CCNG1) ELISA Kit
MBS7217779-01 48 Well

Sheep Cyclin-G1 (CCNG1) ELISA Kit

Sign In for Pricing
View Details