Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-711 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-711 Accession Number: MIMAT0012734 Mature Sequence: GGGACCCAGGGAGAGACGUAAG hsa-miR-711 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-711 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-711 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

FRA1A Protein Vector (Human) (pPB-N-His)
PV079042 500 ng

FRA1A Protein Vector (Human) (pPB-N-His)

Sign In for Pricing
View Details
ATP5PF (NM_001003696) Human Over-expression Lysate
LY423983 100 µg

ATP5PF (NM_001003696) Human Over-expression Lysate

Sign In for Pricing
View Details
Tgif2lx1 Mouse shRNA Lentiviral Particle (Locus ID 245583)
TL507504V 500 µL Each

Tgif2lx1 Mouse shRNA Lentiviral Particle (Locus ID 245583)

Sign In for Pricing
View Details
Human ADAMDEC1 (NM_014479) AAV Particle
RC210181A1V 250 µL

Human ADAMDEC1 (NM_014479) AAV Particle

Sign In for Pricing
View Details
Klk6 ORF Vector (Rat) (pORF)
ORF069142 1.0 µg DNA

Klk6 ORF Vector (Rat) (pORF)

Sign In for Pricing
View Details
Recombinant Human UCP3 Protein, N-His
E55P1998 50 µg

Recombinant Human UCP3 Protein, N-His

Sign In for Pricing
View Details