Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4657 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4657 Accession Number: MIMAT0019724 Mature Sequence: AAUGUGGAAGUGGUCUGAGGCAU hsa-miR-4657 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4657 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4657 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

GATA3 Mouse Monoclonal Antibody [Clone ID: OTI11H3]
TA809113S 30 µL

GATA3 Mouse Monoclonal Antibody [Clone ID: OTI11H3]

Sign In for Pricing
View Details
CHAD (NM_001267) Human Tagged Lenti ORF Clone
RC209958L4 10 µg

CHAD (NM_001267) Human Tagged Lenti ORF Clone

Sign In for Pricing
View Details
Anti-CD200 (Samalizumab)-MC-Vc-PAB-SN38 ADC
ADC-W-792 1 mg

Anti-CD200 (Samalizumab)-MC-Vc-PAB-SN38 ADC

Sign In for Pricing
View Details
CD284 Rabbit Polyclonal Antibody
E53P02553 100 µL

CD284 Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
EphA7 Polyclonal Antibody
MBS9404522-01 0.05 mL

EphA7 Polyclonal Antibody

Sign In for Pricing
View Details
EphA7 Polyclonal Antibody
MBS9404522-02 0.1 mL

EphA7 Polyclonal Antibody

Sign In for Pricing
View Details