Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4498 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4498 Accession Number: MIMAT0019033 Mature Sequence: UGGGCUGGCAGGGCAAGUGCUG hsa-miR-4498 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4498 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4498 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Genorise® beta-Glucuronidase Assay Kit
GR107041 500 Tests

Genorise® beta-Glucuronidase Assay Kit

Sign In for Pricing
View Details
Cd3eap Mouse qPCR Template Standard (NM_145822)
MK204069 1 Kit

Cd3eap Mouse qPCR Template Standard (NM_145822)

Sign In for Pricing
View Details
Apitd1 (Cenps) (NM_027263) Mouse Tagged Lenti ORF Clone
MR221175L4 10 µg

Apitd1 (Cenps) (NM_027263) Mouse Tagged Lenti ORF Clone

Sign In for Pricing
View Details
MIRacle™ hsa-miR-6797-3p miRNA Agomir/Antagomir
AM1855 2 OD, 4 OD, 50 OD

MIRacle™ hsa-miR-6797-3p miRNA Agomir/Antagomir

Sign In for Pricing
View Details
CD6 Antibody (HRP)
E30AH3345 100 µL

CD6 Antibody (HRP)

Sign In for Pricing
View Details
Smr3a (NM_011422) Mouse Tagged Lenti ORF Clone
MR217678L4 10 µg

Smr3a (NM_011422) Mouse Tagged Lenti ORF Clone

Sign In for Pricing
View Details