Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-3679-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-3679-5p Accession Number: MIMAT0018104 Mature Sequence: UGAGGAUAUGGCAGGGAAGGGGA hsa-miR-3679-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-3679-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-3679-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

NSC80644
534403 100.0g

NSC80644

Sign In for Pricing
View Details
FITC Anti-Human IgM Antibody (MHM-88)
FITC-30182-01 20 Tests

FITC Anti-Human IgM Antibody (MHM-88)

Sign In for Pricing
View Details
FITC Anti-Human IgM Antibody (MHM-88)
FITC-30182-02 100 Tests

FITC Anti-Human IgM Antibody (MHM-88)

Sign In for Pricing
View Details
POLD2 (DNA Polymerase delta Subunit 2, DNA Polymerase delta Subunit p50)
131562 100 µg

POLD2 (DNA Polymerase delta Subunit 2, DNA Polymerase delta Subunit p50)

Sign In for Pricing
View Details
SLC25A14 Human qPCR Template Standard (NM_003951)
HK209413 1 Kit

SLC25A14 Human qPCR Template Standard (NM_003951)

Sign In for Pricing
View Details
Mek1 (MAPK/ERK Kinase 1, MEK 1, MEKK1, Dual Specificity Mitogen-activated Protein Kinase Kinase 1, MAP Kinase Kinase 1, Map2k1, MAPKK 1, MAPKK1, Prkmk1, ERK Activator Kinase 1) (MaxLight 405) discontinued
M2865-15-ML405 100 µL

Mek1 (MAPK/ERK Kinase 1, MEK 1, MEKK1, Dual Specificity Mitogen-activated Protein Kinase Kinase 1, MAP Kinase Kinase 1, Map2k1, MAPKK 1, MAPKK1, Prkmk1, ERK Activator Kinase 1) (MaxLight 405) discontinued

Sign In for Pricing
View Details