Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-601 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-601 Accession Number: MIMAT0003269 Mature Sequence: UGGUCUAGGAUUGUUGGAGGAG hsa-miR-601 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-601 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-601 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Znf536 3'UTR Luciferase Stable Cell Line
TU223907 1.0 mL

Znf536 3'UTR Luciferase Stable Cell Line

Sign In for Pricing
View Details
4921517D21Rik sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4121505 3x 1.0 µg

4921517D21Rik sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

Sign In for Pricing
View Details
Recombinant Shigella Boydii macB Protein (aa 1-648)
VAng-Lsx09200-inquire Inquire

Recombinant Shigella Boydii macB Protein (aa 1-648)

Sign In for Pricing
View Details
Anti-CD184/CXCR4 (Recombinant Alpaca, Monoclonal, VHH-8His-Cys-tag)
A134296 100 µL

Anti-CD184/CXCR4 (Recombinant Alpaca, Monoclonal, VHH-8His-Cys-tag)

Sign In for Pricing
View Details
Microtubule Associated Protein Tau (MAPT) Antibody
abx331902 100 µL

Microtubule Associated Protein Tau (MAPT) Antibody

Sign In for Pricing
View Details
Rabbit Polyclonal MED28 Antibody
NBP2-97494-50ul 50 µL

Rabbit Polyclonal MED28 Antibody

Sign In for Pricing
View Details