Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-601 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-601 Accession Number: MIMAT0003269 Mature Sequence: UGGUCUAGGAUUGUUGGAGGAG hsa-miR-601 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-601 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-601 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Human C11orf42 Pre-designed siRNA Set B
SI001767B 1 Each

Human C11orf42 Pre-designed siRNA Set B

Sign In for Pricing
View Details
CASP3 (Caspase 3, CPP32, CPP32B, SCA1, Apoptain, Yama, Apoptosis-Related Cysteine Peptidase, Cysteinyl Aspartate Specific Proteinases 3, SREBP cleavage activity 1)
362410 200 µL

CASP3 (Caspase 3, CPP32, CPP32B, SCA1, Apoptain, Yama, Apoptosis-Related Cysteine Peptidase, Cysteinyl Aspartate Specific Proteinases 3, SREBP cleavage activity 1)

Sign In for Pricing
View Details
Human Cementoblastoma-derived protein 1, CEMP1 ELISA KIT
ELI-10568h 96 Tests

Human Cementoblastoma-derived protein 1, CEMP1 ELISA KIT

Sign In for Pricing
View Details
Alkbh2 (NM_175016) Mouse Recombinant Protein
TP502934 20 µg

Alkbh2 (NM_175016) Mouse Recombinant Protein

Sign In for Pricing
View Details
Recombinant Escherichia coli O157:H7 Uncharacterized protein yhdU (yhdU), partial
MBS1171757-01 0.5 mg (E-Coli)

Recombinant Escherichia coli O157:H7 Uncharacterized protein yhdU (yhdU), partial

Sign In for Pricing
View Details
Recombinant Escherichia coli O157:H7 Uncharacterized protein yhdU (yhdU), partial
MBS1171757-02 0.05 mg (Baculovirus)

Recombinant Escherichia coli O157:H7 Uncharacterized protein yhdU (yhdU), partial

Sign In for Pricing
View Details