Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-934 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-934 Accession Number: MIMAT0004977 Mature Sequence: UGUCUACUACUGGAGACACUGG hsa-miR-934 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-934 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-934 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Rabbit Anti-Human ALKBH7 pAb
PA12902-01 50 μL

Rabbit Anti-Human ALKBH7 pAb

Sign In for Pricing
View Details
Rabbit Anti-Human ALKBH7 pAb
PA12902-02 100 μL

Rabbit Anti-Human ALKBH7 pAb

Sign In for Pricing
View Details
NFKBIL2, NT (TONSL, IKBR, NFKBIL2, Tonsoku-like protein, Inhibitor of kappa B-related protein, NF-kappa-B inhibitor-like protein 2, Nuclear factor of kappa light polypeptide gene enhancer in B Cells inhibitor-like 2) (Biotin) discontinued
038946-Biotin 200 µL

NFKBIL2, NT (TONSL, IKBR, NFKBIL2, Tonsoku-like protein, Inhibitor of kappa B-related protein, NF-kappa-B inhibitor-like protein 2, Nuclear factor of kappa light polypeptide gene enhancer in B Cells inhibitor-like 2) (Biotin) discontinued

Sign In for Pricing
View Details
Mouse Monoclonal BCAM/CD239 Antibody (BRIC221) [DyLight 405]
NB100-66523V 0.1 mL

Mouse Monoclonal BCAM/CD239 Antibody (BRIC221) [DyLight 405]

Sign In for Pricing
View Details
Lentiviral mouse Ppef2 shRNA (UAS) - Lentiviral mouse Ppef2 shRNA (UAS, iRFP) plasmid
GTR15285172 1 Vial

Lentiviral mouse Ppef2 shRNA (UAS) - Lentiviral mouse Ppef2 shRNA (UAS, iRFP) plasmid

Sign In for Pricing
View Details
Horse Granulysin ELISA Kit
MBS073269-01 48 Well

Horse Granulysin ELISA Kit

Sign In for Pricing
View Details