Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-7843-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-7843-5p Accession Number: MIMAT0030411 Mature Sequence: GAGGGCAGAGCCAGCUUCCUGA hsa-miR-7843-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-7843-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-7843-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Rabbit Polyclonal EEF2K [p Ser445] Antibody
NBP3-23311 0.1 mL

Rabbit Polyclonal EEF2K [p Ser445] Antibody

Sign In for Pricing
View Details
HEK293T-Human-COLEC12 Overexpressing Cell Line
RG-1132 5x 10^6

HEK293T-Human-COLEC12 Overexpressing Cell Line

Sign In for Pricing
View Details
C6orf64 Polyclonal Antibody, Cy5.5 Conjugated
bs-9529R-Cy5.5 100 µL

C6orf64 Polyclonal Antibody, Cy5.5 Conjugated

Sign In for Pricing
View Details
Apolipoprotein A-I-binding protein (APOA1BP) Mouse ELISA Kit
B6135 96 Tests

Apolipoprotein A-I-binding protein (APOA1BP) Mouse ELISA Kit

Sign In for Pricing
View Details
Rabbit anti-Saccharomyces cerevisiae (strain 204508/S288c)(Baker's yeast) Q0143 Polyclonal Antibody
MBS9016421 Inquire

Rabbit anti-Saccharomyces cerevisiae (strain 204508/S288c)(Baker's yeast) Q0143 Polyclonal Antibody

Sign In for Pricing
View Details
Rabbit Polyclonal SCAND2 Antibody
NBP3-10382-100ul 100 µL

Rabbit Polyclonal SCAND2 Antibody

Sign In for Pricing
View Details