Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-599 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-599 Accession Number: MIMAT0003267 Mature Sequence: GUUGUGUCAGUUUAUCAAAC hsa-miR-599 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-599 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-599 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

ARHGEF7 (NM_001113513) Human Over-expression Lysate
LY426426 100 µg

ARHGEF7 (NM_001113513) Human Over-expression Lysate

Sign In for Pricing
View Details
Elab Bright™ Violet 650 Anti-Human/Mouse CD44 Antibody[IM7]
E-AB-F1100U 50 Tests

Elab Bright™ Violet 650 Anti-Human/Mouse CD44 Antibody[IM7]

Sign In for Pricing
View Details
7-Benzyloxy-D,L-tryptophan
TRC-B288500-20MG 20 mg

7-Benzyloxy-D,L-tryptophan

Sign In for Pricing
View Details
ENT1 (SLC29A1) Rabbit Polyclonal Antibody
TA381627 100 µL

ENT1 (SLC29A1) Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
Avatrombopag Maleate
TRC-A819920-1G 1 g

Avatrombopag Maleate

Sign In for Pricing
View Details
C2orf76 (NM_001017927) Human Over-expression Lysate
LY422756 100 µg

C2orf76 (NM_001017927) Human Over-expression Lysate

Sign In for Pricing
View Details