Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-5087 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-5087 Accession Number: MIMAT0021079 Mature Sequence: GGGUUUGUAGCUUUGCUGGCAUG hsa-miR-5087 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-5087 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-5087 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

OR1L8 Antibody - C-terminal region : FITC (ARP59701_P050-FITC)
ARP59701_P050-FITC 100 µL

OR1L8 Antibody - C-terminal region : FITC (ARP59701_P050-FITC)

Sign In for Pricing
View Details
Influenza B (Type B Virus, Flu B) (MaxLight 405)
MBS6263604-01 0.1 mL

Influenza B (Type B Virus, Flu B) (MaxLight 405)

Sign In for Pricing
View Details
Influenza B (Type B Virus, Flu B) (MaxLight 405)
MBS6263604-02 5x 0.1 mL

Influenza B (Type B Virus, Flu B) (MaxLight 405)

Sign In for Pricing
View Details
LRRC55 Protein Lysate (Human) with C-Ha Tag
27685031 100 µg

LRRC55 Protein Lysate (Human) with C-Ha Tag

Sign In for Pricing
View Details
FOLH1 Monoclonal Antibody
TA398864 100 µg

FOLH1 Monoclonal Antibody

Sign In for Pricing
View Details
TMC7 Polyclonal Antibody
E44H09056 100 µL

TMC7 Polyclonal Antibody

Sign In for Pricing
View Details