Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-922 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-922 Accession Number: MIMAT0004972 Mature Sequence: GCAGCAGAGAAUAGGACUACGUC hsa-miR-922 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-922 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-922 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Rabbit anti-Arabidopsis thaliana (Mouse-ear cress) At4g08875 Polyclonal Antibody
MBS7192796 Inquire

Rabbit anti-Arabidopsis thaliana (Mouse-ear cress) At4g08875 Polyclonal Antibody

Sign In for Pricing
View Details
THBS4 CRISPR Knock Out 293T Cell Line (Human)
46644141 1x 10^6 Cells / 1.0 mL

THBS4 CRISPR Knock Out 293T Cell Line (Human)

Sign In for Pricing
View Details
ZIC1 Peptide - N-terminal region
MBS3226572-01 0.1 mg

ZIC1 Peptide - N-terminal region

Sign In for Pricing
View Details
ZIC1 Peptide - N-terminal region
MBS3226572-02 5x 0.1 mg

ZIC1 Peptide - N-terminal region

Sign In for Pricing
View Details
GENLISA™ Human C - Met (MET) ELISA
KBH21560 1x 96 Well

GENLISA™ Human C - Met (MET) ELISA

Sign In for Pricing
View Details
Recombinant Human NME7 Protein - (Dry Ice)
H00029922-P01-10ug 10 µg

Recombinant Human NME7 Protein - (Dry Ice)

Sign In for Pricing
View Details