Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-1254 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-1254 Accession Number: MIMAT0005905 Mature Sequence: AGCCUGGAAGCUGGAGCCUGCAGU hsa-miR-1254 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-1254 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-1254 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Anti-ERAB Monoclonal Antibody, Carrier-free
M03844-carrier-free 100 µL

Anti-ERAB Monoclonal Antibody, Carrier-free

Sign In for Pricing
View Details
PLOD1 Mouse mAb
E47M51740 100 µL

PLOD1 Mouse mAb

Sign In for Pricing
View Details
EN1 Recombinant Protein (Mouse)
RP131690 100 µg

EN1 Recombinant Protein (Mouse)

Sign In for Pricing
View Details
ALDH1A3 Over-expression Lysate Product
GWB-7B3ACD 0.1 mg

ALDH1A3 Over-expression Lysate Product

Sign In for Pricing
View Details
PCCA (NM_001127692) Human Tagged Lenti ORF Clone
RC226100L4 10 µg

PCCA (NM_001127692) Human Tagged Lenti ORF Clone

Sign In for Pricing
View Details
Solifenacin hydrochloride
C03716-100mg 100 mg

Solifenacin hydrochloride

Sign In for Pricing
View Details