Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-10b-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-10b-5p Accession Number: MIMAT0000254 Mature Sequence: UACCCUGUAGAACCGAAUUUGUG hsa-miR-10b-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-10b-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-10b-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

ANO6 (AL832340) Human Untagged Clone
SC314869 10 µg

ANO6 (AL832340) Human Untagged Clone

Ask
View Details
Universal RNA Clean-Up Kit
E3589-01 25 Preparations

Universal RNA Clean-Up Kit

Ask
View Details
Ephrin Receptor B4 Antibody (YA4840, Mouse)
HY-P85148 1 Each

Ephrin Receptor B4 Antibody (YA4840, Mouse)

Ask
View Details
Bovine Zinc finger protein 205, ZNF205 ELISA KIT
ELI-51255b 96 Tests

Bovine Zinc finger protein 205, ZNF205 ELISA KIT

Ask
View Details
Recombinant Caenorhabditis elegans Innexin-16 (inx-16), partial
MBS7070419 Inquire

Recombinant Caenorhabditis elegans Innexin-16 (inx-16), partial

Ask
View Details
Fzr1 (NM_001108074) Rat Tagged Lenti ORF Clone
RR202684L3 10 µg

Fzr1 (NM_001108074) Rat Tagged Lenti ORF Clone

Ask
View Details