Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-3167 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-3167 Accession Number: MIMAT0015042 Mature Sequence: AGGAUUUCAGAAAUACUGGUGU hsa-miR-3167 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-3167 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-3167 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Nsf sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4778205 3x 1.0 µg

Nsf sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

Sign In for Pricing
View Details
Lentiviral mouse Ass1 shRNA (UAS) - Lentiviral mouse Ass1 shRNA (UAS, iRFP) plasmid
GTR15187960 1 Vial

Lentiviral mouse Ass1 shRNA (UAS) - Lentiviral mouse Ass1 shRNA (UAS, iRFP) plasmid

Sign In for Pricing
View Details
GOLM1 (Cureab patent GP73) discontinued
048484 100 µg

GOLM1 (Cureab patent GP73) discontinued

Sign In for Pricing
View Details
Spink12 CRISPRa sgRNA lentivector (set of three targets)(Mouse)
45329124 3x 1.0µg DNA

Spink12 CRISPRa sgRNA lentivector (set of three targets)(Mouse)

Sign In for Pricing
View Details
Human AHA1 (AHSA1) (NM_012111) AAV Particle
RC201782A1V 250 µL

Human AHA1 (AHSA1) (NM_012111) AAV Particle

Sign In for Pricing
View Details
Mbp (NM_001025289) Rat Tagged Lenti ORF Clone
RR200507L3 10 µg

Mbp (NM_001025289) Rat Tagged Lenti ORF Clone

Sign In for Pricing
View Details