Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-3167 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-3167 Accession Number: MIMAT0015042 Mature Sequence: AGGAUUUCAGAAAUACUGGUGU hsa-miR-3167 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-3167 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-3167 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

DLPE-PEG-Vinylsulfone
MPL0735K Each

DLPE-PEG-Vinylsulfone

Sign In for Pricing
View Details
Goat Anti-Human IgG-PE
2040-09 0.5 mg

Goat Anti-Human IgG-PE

Sign In for Pricing
View Details
STK33, NT (STK33, Serine/threonine-protein kinase 33) (FITC)
MBS6352085-01 0.2 mL

STK33, NT (STK33, Serine/threonine-protein kinase 33) (FITC)

Sign In for Pricing
View Details
STK33, NT (STK33, Serine/threonine-protein kinase 33) (FITC)
MBS6352085-02 5x 0.2 mL

STK33, NT (STK33, Serine/threonine-protein kinase 33) (FITC)

Sign In for Pricing
View Details
MATK Human shRNA Lentiviral Particle (Locus ID 4145)
TL320414V 500 µL Each

MATK Human shRNA Lentiviral Particle (Locus ID 4145)

Sign In for Pricing
View Details
PSCA (NM_005672) Human Tagged Lenti ORF Clone
RC209136L3 10 µg

PSCA (NM_005672) Human Tagged Lenti ORF Clone

Sign In for Pricing
View Details