Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-6514-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-6514-5p Accession Number: MIMAT0025484 Mature Sequence: UAUGGAGUGGACUUUCAGCUGGC hsa-miR-6514-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-6514-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-6514-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

J Young Wilmad Precision NMR Tube With 5mm NMR Valve 600mhz 7 Long
NMR1287 1 Each

J Young Wilmad Precision NMR Tube With 5mm NMR Valve 600mhz 7 Long

Sign In for Pricing
View Details
Lentiviral human PSMD11 shRNA (UAS) - Lentiviral human PSMD11 shRNA (UAS, iRFP) (100)
GTR15323310 1 Vial

Lentiviral human PSMD11 shRNA (UAS) - Lentiviral human PSMD11 shRNA (UAS, iRFP) (100)

Sign In for Pricing
View Details
Mouse Platelet-activating factor acetylhydrolase (PLA2G7) ELISA Kit
abx514260 96 Well

Mouse Platelet-activating factor acetylhydrolase (PLA2G7) ELISA Kit

Sign In for Pricing
View Details
Recombinant Human Chloride Intracellular Channel 4
7-04834 5 µg

Recombinant Human Chloride Intracellular Channel 4

Sign In for Pricing
View Details
Mouse Synpo2l Pre-designed siRNA Set A
SI114147A 1 Each

Mouse Synpo2l Pre-designed siRNA Set A

Sign In for Pricing
View Details
NDUFS3 Antibody
A29559-50UL 50 μL

NDUFS3 Antibody

Sign In for Pricing
View Details