Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-367-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-367-5p Accession Number: MIMAT0004686 Mature Sequence: ACUGUUGCUAAUAUGCAACUCU hsa-miR-367-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-367-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-367-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Human ROBO4 Antibody , APC
E55A08936 50 Tests

Human ROBO4 Antibody , APC

Sign In for Pricing
View Details
NDUFV2 (NADH Dehydrogenase [Ubiquinone] Flavoprotein 2, Mitochondrial, NADH-ubiquinone Oxidoreductase 24kD Subunit) (MaxLight 405) discontinued
130249-ML405 100 µL

NDUFV2 (NADH Dehydrogenase [Ubiquinone] Flavoprotein 2, Mitochondrial, NADH-ubiquinone Oxidoreductase 24kD Subunit) (MaxLight 405) discontinued

Sign In for Pricing
View Details
β-Glucuronidase Activity Assay Kit (Fluorometric)
K514-100 100 Assays

β-Glucuronidase Activity Assay Kit (Fluorometric)

Sign In for Pricing
View Details
Rabbit anti-Escherichia coli (strain K12) YGDQ Polyclonal Antibody
MBS7161569 Inquire

Rabbit anti-Escherichia coli (strain K12) YGDQ Polyclonal Antibody

Sign In for Pricing
View Details
GNE, CT (GNE, GLCNE, Bifunctional UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase, UDP-GlcNAc-2-epimerase/ManAc kinase, UDP-N-acetylglucosamine 2-epimerase, UDP-GlcNAc-2-epimerase, Uridine diphosphate-N-acetylglucosamine-2-epimerase, N-acetylmannosamine kinase, ManAc kinase) (MaxLight 405) discontinued
036141-ML405 100 µL

GNE, CT (GNE, GLCNE, Bifunctional UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase, UDP-GlcNAc-2-epimerase/ManAc kinase, UDP-N-acetylglucosamine 2-epimerase, UDP-GlcNAc-2-epimerase, Uridine diphosphate-N-acetylglucosamine-2-epimerase, N-acetylmannosamine kinase, ManAc kinase) (MaxLight 405) discontinued

Sign In for Pricing
View Details
Rat Glycerol-3-Phosphate Acyltransferase, Mitochondrial (GPAM) CLIA Kit
abx495591-01 96 Tests

Rat Glycerol-3-Phosphate Acyltransferase, Mitochondrial (GPAM) CLIA Kit

Sign In for Pricing
View Details