Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4644 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4644 Accession Number: MIMAT0019704 Mature Sequence: UGGAGAGAGAAAAGAGACAGAAG hsa-miR-4644 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4644 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4644 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

GST-Tag Mouse Monoclonal Antibody [Clone ID: 25A10.D6.D2]
AM06101PU-N 100 µL

GST-Tag Mouse Monoclonal Antibody [Clone ID: 25A10.D6.D2]

Sign In for Pricing
View Details
APC/Fire™ 750 anti-human CD4
GT12050 100 Tests

APC/Fire™ 750 anti-human CD4

Sign In for Pricing
View Details
beta Catenin (CTNNB1) Mouse Monoclonal Antibody [Clone ID: OTI2D11]
TA500239S 30 µL

beta Catenin (CTNNB1) Mouse Monoclonal Antibody [Clone ID: OTI2D11]

Sign In for Pricing
View Details
Mouse Monoclonal PRPS1 Antibody (1E11) [CoraFluor 1]
NBP2-42649CL1 0.1 mL

Mouse Monoclonal PRPS1 Antibody (1E11) [CoraFluor 1]

Sign In for Pricing
View Details
Mir381 Mouse MicroRNA Expression Plasmid (MI0000798)
SC401028 10 µg

Mir381 Mouse MicroRNA Expression Plasmid (MI0000798)

Sign In for Pricing
View Details
HIPK4 Antibody
MBS7132774-01 0.1 mL

HIPK4 Antibody

Sign In for Pricing
View Details