Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-2052 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-2052 Accession Number: MIMAT0009977 Mature Sequence: UGUUUUGAUAACAGUAAUGU hsa-miR-2052 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-2052 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-2052 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

CDKL5 Human Gene Knockout Kit (CRISPR)
KN418433 1 Kit

CDKL5 Human Gene Knockout Kit (CRISPR)

Sign In for Pricing
View Details
TropomoduLin 2 (TMOD2) (NM_001142885) Human Over-expression Lysate
LC428294 20 µg

TropomoduLin 2 (TMOD2) (NM_001142885) Human Over-expression Lysate

Sign In for Pricing
View Details
Thyroid Peroxidase (TPO) (NM_000547) Human Over-expression Lysate
LY424648 100 µg

Thyroid Peroxidase (TPO) (NM_000547) Human Over-expression Lysate

Sign In for Pricing
View Details
Human PPIC activation kit by CRISPRa
GA103697 1 Kit

Human PPIC activation kit by CRISPRa

Sign In for Pricing
View Details
Factor IX (F9) (NM_000133) Human Over-expression Lysate
LY400045 100 µg

Factor IX (F9) (NM_000133) Human Over-expression Lysate

Sign In for Pricing
View Details
Colloidal Gold Conjugated Goat Affinity Purified Antibody to Rabbit IgG,  10nm
GAF-012-10 1 mL

Colloidal Gold Conjugated Goat Affinity Purified Antibody to Rabbit IgG, 10nm

Sign In for Pricing
View Details