MIRacle™ hsa-miR-409-3p miRNA Agomir/Antagomir
MicroRNA: hsa-miR-409-3p Accession Number: MIMAT0001639 Mature Sequence: GAAUGUUGCUCGGUGAACCCCU hsa-miR-409-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-409-3p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-409-3p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.
Product Specifications
Applications
For research use only
Storage Conditions
Room Temperature
Explore Other Products
Browse additional items from our catalog
AGAP8 Human shRNA Lentiviral Particle (Locus ID 728404)
Eotaxin 3 (C-C Motif Chemokine 26, CC Chemokine IMAC, CCL 26, CCL26, Chemokine (C C Motif) Ligand 26, Chemokine N1, Eotaxin-3, IMAC, Macrophage Inflammatory Protein 4-alpha, MIP 4a, MIP 4alpha, MIP-4-alpha, MIP4a, MIP4alpha, SCYA 26, SCYA26, Small Inducible Cytokine A26, Small Inducible Cytokine Subfamily A (Cys Cys) Member 26, Small Inducible Cytokine Subfamily A Member 26, Small-inducible Cytokine A26, Thymic Stroma Chemokine 1, Thymic Stroma Chemokine-1, TSC 1, TSC-1, TSC1)
