Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-409-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-409-3p Accession Number: MIMAT0001639 Mature Sequence: GAAUGUUGCUCGGUGAACCCCU hsa-miR-409-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-409-3p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-409-3p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Rabbit anti-DP2 Antibody
YLD2601-01 50 µL

Rabbit anti-DP2 Antibody

Sign In for Pricing
View Details
Rabbit anti-DP2 Antibody
YLD2601-02 100 µL

Rabbit anti-DP2 Antibody

Sign In for Pricing
View Details
DOK7, NT (DOK7, C4orf25, Protein Dok-7, Downstream of tyrosine kinase 7) (MaxLight 490) discontinued
034766-ML490 100 µL

DOK7, NT (DOK7, C4orf25, Protein Dok-7, Downstream of tyrosine kinase 7) (MaxLight 490) discontinued

Sign In for Pricing
View Details
Human Pro-Collagen II MAb (Clone 819427R)
MAB3615-100 100 µg

Human Pro-Collagen II MAb (Clone 819427R)

Sign In for Pricing
View Details
trans-Piceatannol
TRC-P436300-10MG 10 mg

trans-Piceatannol

Sign In for Pricing
View Details
Subcloing bundled with gene synthesis3001 bp ~ 5000 bp
GC0012 3001 bp ~ 5000 bp

Subcloing bundled with gene synthesis3001 bp ~ 5000 bp

Sign In for Pricing
View Details