Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-1976 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-1976 Accession Number: MIMAT0009451 Mature Sequence: CCUCCUGCCCUCCUUGCUGU hsa-miR-1976 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-1976 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-1976 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

UBE2J2 Protein Vector (Rat) (pPB-N-His)
PV314091 500 ng

UBE2J2 Protein Vector (Rat) (pPB-N-His)

Sign In for Pricing
View Details
Rabbit Polyclonal SLPI Antibody [DyLight 650]
NBP1-76803C 0.1 mL

Rabbit Polyclonal SLPI Antibody [DyLight 650]

Sign In for Pricing
View Details
Cept1 3'UTR Luciferase Stable Cell Line
TU202205 1.0 mL

Cept1 3'UTR Luciferase Stable Cell Line

Sign In for Pricing
View Details
ZNF519 Human shRNA Lentiviral Particle (Locus ID 162655)
TL307568V 500 µL Each

ZNF519 Human shRNA Lentiviral Particle (Locus ID 162655)

Sign In for Pricing
View Details
Frozen Tissue Sections, Colon
CS512346 5x 5 µm

Frozen Tissue Sections, Colon

Sign In for Pricing
View Details
N-Desmethyl-N-methoxycarbonyl Codeine discontinued
458851-01 2.5 mg

N-Desmethyl-N-methoxycarbonyl Codeine discontinued

Sign In for Pricing
View Details