Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-520h miRNA Agomir/Antagomir

MicroRNA: hsa-miR-520h Accession Number: MIMAT0002867 Mature Sequence: ACAAAGUGCUUCCCUUUAGAGU hsa-miR-520h are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-520h in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-520h miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Human GADD45A qPCR Primer Pair
QH02337S 200 Tests

Human GADD45A qPCR Primer Pair

Sign In for Pricing
View Details
Pleiotropic Regulator 1 (PLRG1) Antibody
abx432047 200 µL

Pleiotropic Regulator 1 (PLRG1) Antibody

Sign In for Pricing
View Details
Fish Golgin A4 (GOLGA4) ELISA Kit
MBS9912142 Inquire

Fish Golgin A4 (GOLGA4) ELISA Kit

Sign In for Pricing
View Details
HDLBP Protein Vector (Human) (pPM-C-HA)
PV082611 500 ng

HDLBP Protein Vector (Human) (pPM-C-HA)

Sign In for Pricing
View Details
Canine Vitamin B1, VB1 ELISA Kit
CELI-66015d 96 Tests

Canine Vitamin B1, VB1 ELISA Kit

Sign In for Pricing
View Details
Pyy siRNA Oligos set (Rat)
38258176 3x 5 nmol

Pyy siRNA Oligos set (Rat)

Sign In for Pricing
View Details