Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

TANGO1-L Human scramble negative control

TANGO1-L Human scramble negative control is the scrambled negative control for TANGO1-L small interfering RNA.

Product Specifications

UNSPSC

12352211

Target

Small Interfering RNA (siRNA)

Type

Reference compound

Related Pathways

Epigenetics

Field of Research

Others

Assay Protocol

https://www.medchemexpress.com/tango1-l-human-scramble-negative-control.html

Purity

97.89

Smiles

[CAGCATCTCTCAAGCAGTCTCTGAC]

Shipping Conditions

Blue Ice

Storage Conditions

-20°C (Powder, sealed storage, away from moisture)

Scientific Category

Reference compound1

Clinical Information

No Development Reported

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Biotin-11-dUTP, 250 nmol
1553-250nmol 250 nmol

Biotin-11-dUTP, 250 nmol

Sign In for Pricing
View Details
Tyrphostin AG1296 10mM * 1mL in DMSO
A16773-10mM-D 10 mM x 1mL in DMSO

Tyrphostin AG1296 10mM * 1mL in DMSO

Sign In for Pricing
View Details
CSGALNACT2 Human shRNA Plasmid Kit (Locus ID 55454)
TL307131 1 Kit

CSGALNACT2 Human shRNA Plasmid Kit (Locus ID 55454)

Sign In for Pricing
View Details
TMEM81 Double Nickase Plasmid (m)
sc-428946-NIC 20 µg

TMEM81 Double Nickase Plasmid (m)

Sign In for Pricing
View Details
Makorin-1 (h3) : 293T Lysate
sc-117304 100 µg - 200 µL

Makorin-1 (h3) : 293T Lysate

Sign In for Pricing
View Details
Rabbit Polyclonal DNCIC1 Antibody [Janelia Fluor 646]
NBP2-97805JF646 0.1 mL

Rabbit Polyclonal DNCIC1 Antibody [Janelia Fluor 646]

Sign In for Pricing
View Details