Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD361 Recombinant Protein

Product Specifications

Background

EVI2B, required for granulocyte differentiation and functionality of hematopoietic progenitor cells through the control of cell cycle progression and survival of hematopoietic progenitor cells.

CAS Number

9000-83-3

Swiss Prot

P34910

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~25kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

AAGACCGAAACCATTACCACCGAAAAACAGAGCCAGCCGACCCTGTTCACCAGTAGTATGAGTCAGGTGCTGGCCAATAGTCAGAATACCACCGGTAATCCGCTGGGCCAGCCGACCCAGTTCAGTGATACCTTCAGTGGCCAGAGTATTAGCCCGGCAAAAGTTACCGCAGGTCAGCCGACCCCGGCCGTGTATACCAGCAGTGAAAAACCGGAAGCCCATACCAGTGCCGGTCAGCCGCTGGCATATAATACCAAACAGCCGACCCCTATTGCAAATACCAGCAGCCAGCAGGCAGTGTTCACCAGCGCACGTCAGCTGCCGAGTGCACGCACCAGCACCACCCAGCCGCCGAAAAGCTTCGTGTATACCTTCACCCAGCAGAGCAGCAGTGTGCAGATTCCGAGCCGCAAACAGATTACCGTGCATAATCCGAGCACCCAGCCGACCAGCACCGTGAAAAATAGTCCGCGTAGTACCCCGGGCTTCATTCTGGATACCACCAGCAATAAACAGACCCCGCAGAAAAATAATTATAATAGC

Available Sizes

More Discoveries

Explore Other Products

Browse additional items from our catalog

MLN4924 (Pevonedistat) 100mg
A11260-100 100 mg

MLN4924 (Pevonedistat) 100mg

Sign In for Pricing
View Details
FOXJ2 3'UTR GFP Stable Cell Line
TU058119 1.0 mL

FOXJ2 3'UTR GFP Stable Cell Line

Sign In for Pricing
View Details
Measles virus (Rubeola)
bsm-72307M 100 µg

Measles virus (Rubeola)

Sign In for Pricing
View Details
ANKRD39 Recombinant Protein (Mouse)
RP115952 100 µg

ANKRD39 Recombinant Protein (Mouse)

Sign In for Pricing
View Details
Research Grade Anti-Human CD172a/SIRPA (AL008)
DHF64004 100 μg

Research Grade Anti-Human CD172a/SIRPA (AL008)

Sign In for Pricing
View Details
CHO Monoclonal CD30/TNFRSF8 Antibody (brentuximab) - Chimeric - (Dry Ice)
NBP3-28178-100ug 100 µg

CHO Monoclonal CD30/TNFRSF8 Antibody (brentuximab) - Chimeric - (Dry Ice)

Sign In for Pricing
View Details