Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD361 Recombinant Protein

Product Specifications

Background

EVI2B, required for granulocyte differentiation and functionality of hematopoietic progenitor cells through the control of cell cycle progression and survival of hematopoietic progenitor cells.

CAS Number

9000-83-3

Swiss Prot

P34910

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~25kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

AAGACCGAAACCATTACCACCGAAAAACAGAGCCAGCCGACCCTGTTCACCAGTAGTATGAGTCAGGTGCTGGCCAATAGTCAGAATACCACCGGTAATCCGCTGGGCCAGCCGACCCAGTTCAGTGATACCTTCAGTGGCCAGAGTATTAGCCCGGCAAAAGTTACCGCAGGTCAGCCGACCCCGGCCGTGTATACCAGCAGTGAAAAACCGGAAGCCCATACCAGTGCCGGTCAGCCGCTGGCATATAATACCAAACAGCCGACCCCTATTGCAAATACCAGCAGCCAGCAGGCAGTGTTCACCAGCGCACGTCAGCTGCCGAGTGCACGCACCAGCACCACCCAGCCGCCGAAAAGCTTCGTGTATACCTTCACCCAGCAGAGCAGCAGTGTGCAGATTCCGAGCCGCAAACAGATTACCGTGCATAATCCGAGCACCCAGCCGACCAGCACCGTGAAAAATAGTCCGCGTAGTACCCCGGGCTTCATTCTGGATACCACCAGCAATAAACAGACCCCGCAGAAAAATAATTATAATAGC

Available Sizes

More Discoveries

Explore Other Products

Browse additional items from our catalog

MCP1 protein
30R-AM026 10 ug

MCP1 protein

Sign In for Pricing
View Details
Anti-PKA alpha+beta (catalytic subunits) Rabbit pAb
GB11598 100 μL

Anti-PKA alpha+beta (catalytic subunits) Rabbit pAb

Sign In for Pricing
View Details
Human Death Associated Protein 3 (DAP3) ELISA Kit
MBS2707677-01 24 Strip Well

Human Death Associated Protein 3 (DAP3) ELISA Kit

Sign In for Pricing
View Details
Human Death Associated Protein 3 (DAP3) ELISA Kit
MBS2707677-02 48 Well

Human Death Associated Protein 3 (DAP3) ELISA Kit

Sign In for Pricing
View Details
Human Death Associated Protein 3 (DAP3) ELISA Kit
MBS2707677-03 96 Well

Human Death Associated Protein 3 (DAP3) ELISA Kit

Sign In for Pricing
View Details
Human Death Associated Protein 3 (DAP3) ELISA Kit
MBS2707677-04 5x 96 Well

Human Death Associated Protein 3 (DAP3) ELISA Kit

Sign In for Pricing
View Details