Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD361 Recombinant Protein

Product Specifications

Background

EVI2B, required for granulocyte differentiation and functionality of hematopoietic progenitor cells through the control of cell cycle progression and survival of hematopoietic progenitor cells.

CAS Number

9000-83-3

Swiss Prot

P34910

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~25kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

AAGACCGAAACCATTACCACCGAAAAACAGAGCCAGCCGACCCTGTTCACCAGTAGTATGAGTCAGGTGCTGGCCAATAGTCAGAATACCACCGGTAATCCGCTGGGCCAGCCGACCCAGTTCAGTGATACCTTCAGTGGCCAGAGTATTAGCCCGGCAAAAGTTACCGCAGGTCAGCCGACCCCGGCCGTGTATACCAGCAGTGAAAAACCGGAAGCCCATACCAGTGCCGGTCAGCCGCTGGCATATAATACCAAACAGCCGACCCCTATTGCAAATACCAGCAGCCAGCAGGCAGTGTTCACCAGCGCACGTCAGCTGCCGAGTGCACGCACCAGCACCACCCAGCCGCCGAAAAGCTTCGTGTATACCTTCACCCAGCAGAGCAGCAGTGTGCAGATTCCGAGCCGCAAACAGATTACCGTGCATAATCCGAGCACCCAGCCGACCAGCACCGTGAAAAATAGTCCGCGTAGTACCCCGGGCTTCATTCTGGATACCACCAGCAATAAACAGACCCCGCAGAAAAATAATTATAATAGC

Available Sizes

More Discoveries

Explore Other Products

Browse additional items from our catalog

2-Amino-3-chloro-1,4-naphthoquinone
TRC-A604203-10G 10 g

2-Amino-3-chloro-1,4-naphthoquinone

Sign In for Pricing
View Details
Prokineticin 1 (PROK1) (NM_032414) Human Tagged Lenti ORF Clone
RC205595L3 10 µg

Prokineticin 1 (PROK1) (NM_032414) Human Tagged Lenti ORF Clone

Sign In for Pricing
View Details
Lentiviral mouse Cd55b shRNA (UAS) - Lentiviral mouse Cd55b shRNA (UAS) (25)
GTR15212201 1 Vial

Lentiviral mouse Cd55b shRNA (UAS) - Lentiviral mouse Cd55b shRNA (UAS) (25)

Sign In for Pricing
View Details
Guinea pig Fibroblast Growth Factor 6, Basic (FGF6) ELISA Kit
MBS261598-01 48 Well

Guinea pig Fibroblast Growth Factor 6, Basic (FGF6) ELISA Kit

Sign In for Pricing
View Details
Guinea pig Fibroblast Growth Factor 6, Basic (FGF6) ELISA Kit
MBS261598-02 96 Well

Guinea pig Fibroblast Growth Factor 6, Basic (FGF6) ELISA Kit

Sign In for Pricing
View Details
Guinea pig Fibroblast Growth Factor 6, Basic (FGF6) ELISA Kit
MBS261598-03 5x 96 Well

Guinea pig Fibroblast Growth Factor 6, Basic (FGF6) ELISA Kit

Sign In for Pricing
View Details