Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD360 Recombinant Protein

Product Specifications

Background

The IL-21 receptor (also designated IL-21R, NILR or novel interleukin receptor) is a type I cytokine receptor that forms a complex with the cytokine receptor γ chain, γc and mediates IL-21 signaling. IL-21R is present on the surface of natural killer, B and T cell populations with high levels in spleen and thymus. IL-21 and IL-21R influence lymphoid proliferation and early lymphoid development in the transition between innate and adaptive immunity. Tumor necrosis factor (TNF) upregulates IL-21R, and combinations of TNF and IL-21 can have synergistic effects on myeloma cell proliferation through pathways involving phosphorylation of JAK1, Stat3 and Erk1/2. The human IL-21R gene maps to chromosome 16p12.1 and encodes a 538 amino acid protein that is closely related to human IL2RB and shares 62% sequence identity to mouse Il21r.

CAS Number

9000-83-3

Swiss Prot

Q9HBE5

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~31kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

TGTCCGGATCTGGTGTGTTATACCGATTATCTGCAGACCGTTATCTGTATTCTGGAAATGTGGAATCTGCATCCGAGTACCCTGACCCTGACCTGGCAGGATCAGTATGAAGAACTGAAAGATGAAGCCACCAGCTGTAGTCTGCATCGCAGCGCACATAATGCCACCCATGCCACCTATACCTGTCACATGGATGTGTTCCACTTCATGGCCGATGATATCTTCAGCGTGAATATTACCGATCAGAGCGGCAATTATAGTCAGGAATGCGGTAGCTTCCTGCTGGCAGAAAGTATTAAACCGGCACCGCCGTTCAATGTGACCGTGACCTTCAGCGGTCAGTATAATATTAGCTGGCGCAGTGATTATGAAGATCCGGCCTTCTATATGCTGAAAGGCAAACTGCAGTATGAACTGCAGTATCGTAATCGCGGCGATCCGTGGGCAGTTAGCCCGCGTCGTAAACTGATTAGCGTTGATAGCCGTAGTGTGAGTCTGCTGCCGCTGGAATTCCGTAAAGATAGCAGCTATGAACTGCAAGTTCGCGCCGGCCCGATGCCGGGTAGCTCATATCAGGGCACCTGGAGCGAATGGAGTGATCCGGTTATCTTCCAGACCCAGAGTGAAGAACTGAAGGAA

Available Sizes

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

(±)-Napropamide-d10 (N,N-diethyl-d10)
TRC-N378701-5MG 5 mg

(±)-Napropamide-d10 (N,N-diethyl-d10)

Ask
View Details
Interleukin 20 (Interleukin-20, IL-20, IL20, Cytokine Zcyto10, IL10D, MGC96907, UNQ852/PRO1801, ZCYTO10) APC
MBS6382982-01 0.1 mL

Interleukin 20 (Interleukin-20, IL-20, IL20, Cytokine Zcyto10, IL10D, MGC96907, UNQ852/PRO1801, ZCYTO10) APC

Ask
View Details
Interleukin 20 (Interleukin-20, IL-20, IL20, Cytokine Zcyto10, IL10D, MGC96907, UNQ852/PRO1801, ZCYTO10) APC
MBS6382982-02 5x 0.1 mL

Interleukin 20 (Interleukin-20, IL-20, IL20, Cytokine Zcyto10, IL10D, MGC96907, UNQ852/PRO1801, ZCYTO10) APC

Ask
View Details
Cholic acid-cysteine-cyanuric chloride complex
MF-0128563-01 10 mg

Cholic acid-cysteine-cyanuric chloride complex

Ask
View Details
Cholic acid-cysteine-cyanuric chloride complex
MF-0128563-02 50 mg

Cholic acid-cysteine-cyanuric chloride complex

Ask
View Details
PRSS42 (Serine Protease 42, 3421-, Testis Serine Protease 2, PRSS42, TESSP2) (MaxLight 490)
MBS6458511-01 0.1 mL

PRSS42 (Serine Protease 42, 3421-, Testis Serine Protease 2, PRSS42, TESSP2) (MaxLight 490)

Ask
View Details