CD360 Recombinant Protein
Product Specifications
Background
The IL-21 receptor (also designated IL-21R, NILR or novel interleukin receptor) is a type I cytokine receptor that forms a complex with the cytokine receptor γ chain, γc and mediates IL-21 signaling. IL-21R is present on the surface of natural killer, B and T cell populations with high levels in spleen and thymus. IL-21 and IL-21R influence lymphoid proliferation and early lymphoid development in the transition between innate and adaptive immunity. Tumor necrosis factor (TNF) upregulates IL-21R, and combinations of TNF and IL-21 can have synergistic effects on myeloma cell proliferation through pathways involving phosphorylation of JAK1, Stat3 and Erk1/2. The human IL-21R gene maps to chromosome 16p12.1 and encodes a 538 amino acid protein that is closely related to human IL2RB and shares 62% sequence identity to mouse Il21r.
Swiss Prot
Q9HBE5
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~31kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
CAS Number
9000-83-3
AA Sequence
TGTCCGGATCTGGTGTGTTATACCGATTATCTGCAGACCGTTATCTGTATTCTGGAAATGTGGAATCTGCATCCGAGTACCCTGACCCTGACCTGGCAGGATCAGTATGAAGAACTGAAAGATGAAGCCACCAGCTGTAGTCTGCATCGCAGCGCACATAATGCCACCCATGCCACCTATACCTGTCACATGGATGTGTTCCACTTCATGGCCGATGATATCTTCAGCGTGAATATTACCGATCAGAGCGGCAATTATAGTCAGGAATGCGGTAGCTTCCTGCTGGCAGAAAGTATTAAACCGGCACCGCCGTTCAATGTGACCGTGACCTTCAGCGGTCAGTATAATATTAGCTGGCGCAGTGATTATGAAGATCCGGCCTTCTATATGCTGAAAGGCAAACTGCAGTATGAACTGCAGTATCGTAATCGCGGCGATCCGTGGGCAGTTAGCCCGCGTCGTAAACTGATTAGCGTTGATAGCCGTAGTGTGAGTCTGCTGCCGCTGGAATTCCGTAAAGATAGCAGCTATGAACTGCAAGTTCGCGCCGGCCCGATGCCGGGTAGCTCATATCAGGGCACCTGGAGCGAATGGAGTGATCCGGTTATCTTCCAGACCCAGAGTGAAGAACTGAAGGAA
Available Sizes
Curated Selection
Explore Other Products
Discover premium biology products from our extensive collection of 20M+ items