Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD358 Recombinant Protein

Product Specifications

Background

The tumor necrosis factor receptor family, which includes TNF-RI, Fas, DR3, DR4, DR5, and DR6, plays an important role in the regulation of apoptosis in various physiological systems. The receptors are activated by a family of cytokines that include TNF, FasL, and TNF-related apoptosis-inducing ligand (TRAIL) . They are characterized by a highly conserved extracellular region containing cysteine-rich repeats and a conserved intracellular region of about 80 amino acids termed the death domain (DD) . The DD is important for transducing the death signal by recruiting other DD containing adaptor proteins (FADD, TRADD, RIP) to the death-inducing signaling complex (DISC), resulting in activation of caspases. DR6, also known as TNFRSF21, is a TNFR family member able to induce apoptosis as well as activation of NF-κB and JNK. Expression of DR6 is upregulated by NF-κB signaling. DR6 appears to play a critical role in the activation and differentiation of T and B lymphocytes. In the nervous system, β-amyloid precursor protein (APP) activates DR6 to trigger neuronal degeneration.

CAS Number

9000-83-3

Swiss Prot

O75509

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~35kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

CAGCCTGAACAGAAAGCCAGTAATCTGATTGGTACCTATCGCCATGTTGATCGCGCCACCGGTCAGGTGCTGACCTGCGATAAATGTCCGGCAGGCACCTATGTTAGCGAACATTGTACCAATACCAGTCTGCGCGTGTGCAGTAGCTGTCCGGTTGGTACCTTCACCCGTCATGAAAATGGCATTGAAAAATGCCATGATTGTAGTCAGCCGTGTCCGTGGCCGATGATTGAAAAACTGCCGTGCGCCGCCCTGACCGATCGCGAATGTACCTGCCCGCCGGGCATGTTCCAGAGTAATGCAACCTGCGCCCCGCATACCGTGTGTCCGGTTGGCTGGGGTGTTCGTAAAAAAGGTACCGAAACCGAAGATGTGCGTTGTAAACAGTGTGCCCGCGGTACCTTCAGCGATGTGCCGAGCAGCGTTATGAAATGCAAAGCATATACCGATTGCCTGAGCCAGAATCTGGTTGTGATTAAACCGGGCACCAAAGAAACCGATAATGTGTGTGGCACCCTGCCGAGCTTCAGTAGCAGTACCAGCCCGAGTCCGGGCACCGCAATCTTCCCGCGCCCGGAACACATGGAAACACATGAAGTGCCGAGCTCAACCTATGTGCCGAAAGGTATGAATAGCACCGAAAGTAATAGCAGTGCCAGTGTTCGCCCGAAAGTTCTGAGCAGCATTCAGGAAGGCACCGTTCCGGATAATACCAGTAGTGCCCGTGGTAAAGAAGATGTTAATAAAACCTTACCGAACCTGCAGGTTGTTAATCATCAGCAGGGTCCGCATCATCGTCATATTCTGAAACTGCTGCCGAGCATGGAAGCAACCGGCGGCGAAAAAAGCAGTACCCCGATTAAAGGTCCGAAACGCGGTCATCCGCGCCAGAATCTGCATAAACACTTCGATATTAATGAGCAT

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Slitrk1 Rat Pre-designed siRNA Set A
HY-RS26726 1 Set

Slitrk1 Rat Pre-designed siRNA Set A

Sign In for Pricing
View Details
DSCC1 Antibody, FITC conjugated
CSB-PA887133LC01HU-01 50 µg

DSCC1 Antibody, FITC conjugated

Sign In for Pricing
View Details
DSCC1 Antibody, FITC conjugated
CSB-PA887133LC01HU-02 100 µg

DSCC1 Antibody, FITC conjugated

Sign In for Pricing
View Details
N-Boc-PEG1-bromide
HY-130503-01 100 mg

N-Boc-PEG1-bromide

Sign In for Pricing
View Details
N-Boc-PEG1-bromide
HY-130503-02 250 mg

N-Boc-PEG1-bromide

Sign In for Pricing
View Details
N-Boc-PEG1-bromide
HY-130503-03 500 mg

N-Boc-PEG1-bromide

Sign In for Pricing
View Details