Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD357 Recombinant Protein

Product Specifications

Background

TNFRSF18, also known as glucocorticoid-induced tumor necrosis factor-receptor (TNFR) -related protein (GITR) and activation-inducible TNFR family receptor, encodes a type 1 membrane protein of the TNF-receptor superfamily. Three alternatively spliced transcript variants encoding distinct isoforms have been reported. GITR is an immune cell co-stimulatory receptor expressed constitutively at high levels on CD4+CD25+ T regulatory cells (Tregs), at low levels on naïve and memory T cells, and is induced upon T cell activation. Studies show GITR can also be induced on NK cells, macrophages, and DCs. Although GITR does not have intrinsic enzymatic activity, TNFSF18 (also known as GITRL) expressed on antigen presenting cells binds to GITR, resulting in recruitment of TNFR-associated factor family members and activation of the NF-κB pathway in T cells. GITR ligation has been shown to play a role in CD8+ T cell activation, cytotoxicity, and memory T cell survival. In the thymus, GITR is thought to play a key role in dominant immunological self-tolerance through thymic Treg differentiation and expansion. Of note, GITR ligation inhibits Treg suppressive function and promotes effector T cell resistance to Treg suppression. Due to the combined effects on both Treg suppression and effector cell activation, GITR represents a unique opportunity for immunotherapeutic intervention in cancer.

CAS Number

9000-83-3

Swiss Prot

Q9Y5U5

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~22kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

CAGCGTCCTACCGGTGGCCCTGGTTGTGGTCCGGGTCGTCTGCTGCTGGGTACCGGTACCGATGCACGTTGTTGTCGTGTTCATACCACCCGCTGTTGTCGCGATTATCCGGGCGAAGAATGCTGTAGCGAATGGGATTGTATGTGCGTTCAGCCGGAATTCCATTGTGGCGATCCGTGTTGTACCACCTGTCGTCATCATCCGTGTCCGCCGGGCCAGGGTGTGCAGTCACAGGGTAAATTCAGCTTCGGCTTCCAGTGCATTGATTGTGCCAGTGGCACCTTCAGCGGTGGCCATGAAGGTCATTGCAAACCGTGGACCGATTGTACCCAGTTCGGCTTCCTGACCGTGTTCCCGGGCAATAAAACACATAATGCCGTGTGTGTTCCGGGTAGCCCGCCGGCAGAACCG

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

RANBP3L (NM_001161429) Human Over-expression Lysate
LY431433 100 µg

RANBP3L (NM_001161429) Human Over-expression Lysate

Sign In for Pricing
View Details
alpha-Cyclodextrin
TRC-C988470-2.5G 2.5 g

alpha-Cyclodextrin

Sign In for Pricing
View Details
Filaggrin (Keratinocyte Differentiation Marker) (FLG/1945), CF647 conjugate, 0.1mg/mL
BNC471945-100 1x 100 µL

Filaggrin (Keratinocyte Differentiation Marker) (FLG/1945), CF647 conjugate, 0.1mg/mL

Sign In for Pricing
View Details
Amplite® Fluorimetric Alkaline Phosphatase Assay Kit *Green Fluorescence*
11953-AAT 500 Tests

Amplite® Fluorimetric Alkaline Phosphatase Assay Kit *Green Fluorescence*

Sign In for Pricing
View Details
Prolactin (PRL) (C-term) Rabbit Polyclonal Antibody
AP53447PU-N 400 µL

Prolactin (PRL) (C-term) Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
Human PTIP (PAXIP1) activation kit by CRISPRa
GA107939 1 Kit

Human PTIP (PAXIP1) activation kit by CRISPRa

Sign In for Pricing
View Details