Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD355 Recombinant Protein

Product Specifications

Background

CD355, mediates heterophilic cell-cell adhesion which regulates the activation, differentiation and tissue retention of various T-cell subsets. Interaction with CADM1 promotes natural killer (NK) cell cytotoxicity and IFNG/interferon-gamma secretion by CD8+ T-cells in vitro as well as NK cell-mediated rejection of tumors expressing CADM1 in vivo. Regulates CD8+ T-cell proliferation in response to T-cell receptor (TCR) activation. Appears to be dispensable for CD8+ T-cell-mediated cytotoxicity. Interaction with SCRIB promotes the late phase of cellular polarization of a subset of CD4+ T-cells, which in turn regulates TCR-mediated proliferation and IFNG, IL17 and IL22 production. By interacting with CADM1 on CD8+ dendritic cells, regulates the retention of activated CD8+ T-cells within the draining lymph node (By similarity) . Required for the intestinal retention of intraepithelial CD4+ CD8+ T-cells and, to a lesser extent, intraepithelial and lamina propria CD8+ T-cells and CD4+ T-cells (By similarity) . Interaction with CADM1 promotes the adhesion to gut-associated CD103+ dendritic cells, which may facilitate the expression of gut-homing and adhesion molecules on T-cells and the conversion of CD4+ T-cells into CD4+ CD8+ T-cells (By similarity) .

CAS Number

9000-83-3

Swiss Prot

O95727

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~40kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

AGCCTGACCAATCATACCGAAACCATTACCGTTGAAGAAGGCCAGACCCTGACCCTGAAATGTGTGACCAGTCTGCGTAAAAATAGTAGCCTGCAGTGGCTGACCCCGAGCGGCTTCACCATCTTCCTGAATGAATATCCGGCCCTGAAAAATAGCAAATATCAGCTGCTGCATCATAGCGCAAATCAGCTGAGCATTACCGTGCCGAATGTTACCCTGCAGGATGAAGGCGTGTATAAATGCCTGCATTATAGTGATAGTGTGAGCACCAAAGAAGTGAAAGTTATTGTGCTGGCAACCCCGTTCAAACCGATTCTGGAAGCAAGTGTTATTCGTAAACAGAATGGCGAAGAACATGTGGTTCTGATGTGTAGTACCATGCGTAGCAAACCGCCGCCGCAGATTACCTGGCTGCTGGGTAATAGCATGGAAGTGAGCGGCGGTACCCTGCATGAATTCGAAACCGATGGTAAAAAATGCAATACCACCAGCACCCTGATTATTCATACCTATGGTAAAAATAGCACCGTTGATTGTATTATTCGTCATCGTGGTCTGCAGGGTCGCAAACTGGTTGCACCGTTCCGCTTCGAAGATCTGGTGACCGATGAAGAAACCGCCAGCGATGCACTGGAACGCAATAGCCTGAGTAGCCAGGATCCGCAGCAGCCGACCAGCACCGTTAGCGTTACCGAAGATAGCAGCACCAGTGAAATTGATAAAGAAGAAAAAGAGCAGACCACCCAGGATCCGGATCTGACCACCGAAGCCAATCCGCAGTATCTGGGCCTGGCACGTAAAAAAAGCGGC

Available Sizes

More Discoveries

Explore Other Products

Browse additional items from our catalog

TRAK1 CRISPRa sgRNA lentivector (set of three targets)(Rat)
47503126 3x 1.0µg DNA

TRAK1 CRISPRa sgRNA lentivector (set of three targets)(Rat)

Sign In for Pricing
View Details
Mouse Iba57 qPCR Primer Pair
QM55982S 200 Tests

Mouse Iba57 qPCR Primer Pair

Sign In for Pricing
View Details
MIPOL1 3'UTR Luciferase Stable Cell Line
TU013374 1.0 mL

MIPOL1 3'UTR Luciferase Stable Cell Line

Sign In for Pricing
View Details
Mmp1b 3'UTR GFP Stable Cell Line
TU263268 1.0 mL

Mmp1b 3'UTR GFP Stable Cell Line

Sign In for Pricing
View Details
Rabbit Monoclonal BCMA/TNFRSF17 Antibody (049) [Alexa Fluor 488]
NBP3-12791AF488 100 µL

Rabbit Monoclonal BCMA/TNFRSF17 Antibody (049) [Alexa Fluor 488]

Sign In for Pricing
View Details
Human PNOC ELISA Kit
ELA-E0932h 96 Tests

Human PNOC ELISA Kit

Sign In for Pricing
View Details