Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD355 Recombinant Protein

Product Specifications

Background

CD355, mediates heterophilic cell-cell adhesion which regulates the activation, differentiation and tissue retention of various T-cell subsets. Interaction with CADM1 promotes natural killer (NK) cell cytotoxicity and IFNG/interferon-gamma secretion by CD8+ T-cells in vitro as well as NK cell-mediated rejection of tumors expressing CADM1 in vivo. Regulates CD8+ T-cell proliferation in response to T-cell receptor (TCR) activation. Appears to be dispensable for CD8+ T-cell-mediated cytotoxicity. Interaction with SCRIB promotes the late phase of cellular polarization of a subset of CD4+ T-cells, which in turn regulates TCR-mediated proliferation and IFNG, IL17 and IL22 production. By interacting with CADM1 on CD8+ dendritic cells, regulates the retention of activated CD8+ T-cells within the draining lymph node (By similarity) . Required for the intestinal retention of intraepithelial CD4+ CD8+ T-cells and, to a lesser extent, intraepithelial and lamina propria CD8+ T-cells and CD4+ T-cells (By similarity) . Interaction with CADM1 promotes the adhesion to gut-associated CD103+ dendritic cells, which may facilitate the expression of gut-homing and adhesion molecules on T-cells and the conversion of CD4+ T-cells into CD4+ CD8+ T-cells (By similarity) .

CAS Number

9000-83-3

Swiss Prot

O95727

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~40kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

AGCCTGACCAATCATACCGAAACCATTACCGTTGAAGAAGGCCAGACCCTGACCCTGAAATGTGTGACCAGTCTGCGTAAAAATAGTAGCCTGCAGTGGCTGACCCCGAGCGGCTTCACCATCTTCCTGAATGAATATCCGGCCCTGAAAAATAGCAAATATCAGCTGCTGCATCATAGCGCAAATCAGCTGAGCATTACCGTGCCGAATGTTACCCTGCAGGATGAAGGCGTGTATAAATGCCTGCATTATAGTGATAGTGTGAGCACCAAAGAAGTGAAAGTTATTGTGCTGGCAACCCCGTTCAAACCGATTCTGGAAGCAAGTGTTATTCGTAAACAGAATGGCGAAGAACATGTGGTTCTGATGTGTAGTACCATGCGTAGCAAACCGCCGCCGCAGATTACCTGGCTGCTGGGTAATAGCATGGAAGTGAGCGGCGGTACCCTGCATGAATTCGAAACCGATGGTAAAAAATGCAATACCACCAGCACCCTGATTATTCATACCTATGGTAAAAATAGCACCGTTGATTGTATTATTCGTCATCGTGGTCTGCAGGGTCGCAAACTGGTTGCACCGTTCCGCTTCGAAGATCTGGTGACCGATGAAGAAACCGCCAGCGATGCACTGGAACGCAATAGCCTGAGTAGCCAGGATCCGCAGCAGCCGACCAGCACCGTTAGCGTTACCGAAGATAGCAGCACCAGTGAAATTGATAAAGAAGAAAAAGAGCAGACCACCCAGGATCCGGATCTGACCACCGAAGCCAATCCGCAGTATCTGGGCCTGGCACGTAAAAAAAGCGGC

Available Sizes

More Discoveries

Explore Other Products

Browse additional items from our catalog

4933417A18Rik sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3273003 1.0 µg DNA

4933417A18Rik sgRNA CRISPR Lentivector (Mouse) (Target 2)

Sign In for Pricing
View Details
MIR7117 Mouse qPCR Template Standard (MI0022968)
MK301084 200 Reactions

MIR7117 Mouse qPCR Template Standard (MI0022968)

Sign In for Pricing
View Details
ATG10, NT (APG10, APG10L, DKFZp586I0418, FLJ13954, pp12616, APG10 autophagy 10-like, APG10-like, autophagy-related protein 10) (MaxLight 650)
MBS6275916-01 0.1 mL

ATG10, NT (APG10, APG10L, DKFZp586I0418, FLJ13954, pp12616, APG10 autophagy 10-like, APG10-like, autophagy-related protein 10) (MaxLight 650)

Sign In for Pricing
View Details
ATG10, NT (APG10, APG10L, DKFZp586I0418, FLJ13954, pp12616, APG10 autophagy 10-like, APG10-like, autophagy-related protein 10) (MaxLight 650)
MBS6275916-02 5x 0.1 mL

ATG10, NT (APG10, APG10L, DKFZp586I0418, FLJ13954, pp12616, APG10 autophagy 10-like, APG10-like, autophagy-related protein 10) (MaxLight 650)

Sign In for Pricing
View Details
Human RBM4B Knockout HEK293T cell line
GTR15412293 1 Vial

Human RBM4B Knockout HEK293T cell line

Sign In for Pricing
View Details
Recombinant Chlamydophila Trachomatis ltuB Protein (aa 1-97)
VAng-Lsx6835-500gEcoli 500 µg (E. coli)

Recombinant Chlamydophila Trachomatis ltuB Protein (aa 1-97)

Sign In for Pricing
View Details