Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD354 Recombinant Protein

Product Specifications

Background

TREM-1 (triggering receptor expressed on myeloid cells-1) is expressed in monocytes and neutrophils but not in lymphocytes, dendritic cells, or other cell types. TREM-1 is a glycoprotein that is reduced by deglycosylation, in agreement with the predicted molecular mass. TREM-1 is an activating receptor of the Ig superfamily that is expressed on human myeloid cells, selectively expressed on blood neutrophils and a subset of monocytes, and is upregulated by bacterial LPS. Immunoblot analysis shows that TREM-1 is associated with DAP12, a molecule frequently associated with activating receptors. TREM-1 and the myeloid DAP12-associating lectin (MDL-1) are recently identified receptors which associate non-covalently with DAP12 to form receptor complexes that are involved in monocytic activation and inflammatory response.

CAS Number

9000-83-3

Swiss Prot

Q9NP99

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~24kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GCAACCAAACTGACCGAAGAAAAATATGAACTGAAAGAAGGTCAGACCCTGGATGTGAAATGCGATTATACCCTGGAAAAATTCGCAAGTAGCCAGAAAGCATGGCAGATTATTCGTGATGGCGAAATGCCGAAAACCTTAGCCTGTACCGAACGTCCGAGCAAAAATAGTCATCCGGTTCAGGTTGGCCGCATTATTCTGGAAGATTATCATGATCATGGTCTGCTGCGCGTGCGTATGGTTAATCTGCAGGTGGAAGATAGTGGTCTGTATCAGTGCGTGATCTATCAGCCGCCGAAAGAACCGCACATGCTGTTCGATCGTATTCGTCTGGTGGTTACCAAAGGCTTCAGTGGCACCCCGGGTAGTAATGAAAATAGCACCCAGAATGTGTATAAAATTCCGCCGACCACCACCAAAGCCCTGTGTCCGCTGTATACCAGCCCGCGCACCGTTACCCAGGCCCCTCCTAAAAGCACCGCCGATGTGAGTACCCCGGATAGCGAAATTAATCTGACCAATGTTACCGATATTATCCGCGTTCCGGTGTTCAAT

Available Sizes

More Discoveries

Explore Other Products

Browse additional items from our catalog

Serotonin receptor 3E antibody
MBS5300400-01 0.1 mL

Serotonin receptor 3E antibody

Sign In for Pricing
View Details
Serotonin receptor 3E antibody
MBS5300400-02 5x 0.1 mL

Serotonin receptor 3E antibody

Sign In for Pricing
View Details
Spata6 (NM_026470) Mouse Tagged Lenti ORF Clone
MR218585L3 10 µg

Spata6 (NM_026470) Mouse Tagged Lenti ORF Clone

Sign In for Pricing
View Details
LOC389458 (NM_203393) Human Tagged ORF Clone Lentiviral Particle
RC206721L3V 200 µL

LOC389458 (NM_203393) Human Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
Serpinb6a Mouse Gene Knockout Kit (CRISPR)
KN515588 1 Kit

Serpinb6a Mouse Gene Knockout Kit (CRISPR)

Sign In for Pricing
View Details
Mouse Monoclonal Rab17 Antibody (OTI5E2) [DyLight 350]
NBP2-73765UV 0.1 mL

Mouse Monoclonal Rab17 Antibody (OTI5E2) [DyLight 350]

Sign In for Pricing
View Details