Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD354 Recombinant Protein

Product Specifications

Background

TREM-1 (triggering receptor expressed on myeloid cells-1) is expressed in monocytes and neutrophils but not in lymphocytes, dendritic cells, or other cell types. TREM-1 is a glycoprotein that is reduced by deglycosylation, in agreement with the predicted molecular mass. TREM-1 is an activating receptor of the Ig superfamily that is expressed on human myeloid cells, selectively expressed on blood neutrophils and a subset of monocytes, and is upregulated by bacterial LPS. Immunoblot analysis shows that TREM-1 is associated with DAP12, a molecule frequently associated with activating receptors. TREM-1 and the myeloid DAP12-associating lectin (MDL-1) are recently identified receptors which associate non-covalently with DAP12 to form receptor complexes that are involved in monocytic activation and inflammatory response.

CAS Number

9000-83-3

Swiss Prot

Q9NP99

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~24kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GCAACCAAACTGACCGAAGAAAAATATGAACTGAAAGAAGGTCAGACCCTGGATGTGAAATGCGATTATACCCTGGAAAAATTCGCAAGTAGCCAGAAAGCATGGCAGATTATTCGTGATGGCGAAATGCCGAAAACCTTAGCCTGTACCGAACGTCCGAGCAAAAATAGTCATCCGGTTCAGGTTGGCCGCATTATTCTGGAAGATTATCATGATCATGGTCTGCTGCGCGTGCGTATGGTTAATCTGCAGGTGGAAGATAGTGGTCTGTATCAGTGCGTGATCTATCAGCCGCCGAAAGAACCGCACATGCTGTTCGATCGTATTCGTCTGGTGGTTACCAAAGGCTTCAGTGGCACCCCGGGTAGTAATGAAAATAGCACCCAGAATGTGTATAAAATTCCGCCGACCACCACCAAAGCCCTGTGTCCGCTGTATACCAGCCCGCGCACCGTTACCCAGGCCCCTCCTAAAAGCACCGCCGATGTGAGTACCCCGGATAGCGAAATTAATCTGACCAATGTTACCGATATTATCCGCGTTCCGGTGTTCAAT

Available Sizes

More Discoveries

Explore Other Products

Browse additional items from our catalog

Human CLEC9a Alexa Fluor 647 Antibody (Clone 683409)
FAB6049R-100UG 100 µg

Human CLEC9a Alexa Fluor 647 Antibody (Clone 683409)

Sign In for Pricing
View Details
TYRP1 (Tyrosinase-related Protein 1, TRP1, TRP-1, TRP, TYRP, TYRRP, 5,6-dihydroxyindole-2-carboxylic Acid Oxidase, DHICA Oxidase, Catalase B, CATB, CAS2, Glycoprotein 75, GP75, Melanoma Antigen gp75) (MaxLight 405) discontinued
134963-ML405 100 µL

TYRP1 (Tyrosinase-related Protein 1, TRP1, TRP-1, TRP, TYRP, TYRRP, 5,6-dihydroxyindole-2-carboxylic Acid Oxidase, DHICA Oxidase, Catalase B, CATB, CAS2, Glycoprotein 75, GP75, Melanoma Antigen gp75) (MaxLight 405) discontinued

Sign In for Pricing
View Details
PAK4-IN-6
MF-0118716-01 10 mg

PAK4-IN-6

Sign In for Pricing
View Details
PAK4-IN-6
MF-0118716-02 50 mg

PAK4-IN-6

Sign In for Pricing
View Details
Recombinant Human DNA ligase 1 Protein, GST, E.coli-200ug
QP6308-ec-200ug 200ug

Recombinant Human DNA ligase 1 Protein, GST, E.coli-200ug

Sign In for Pricing
View Details
Rabbit anti-SNRNP200 Antibody, Affinity Purified
A303-453A 20 µg

Rabbit anti-SNRNP200 Antibody, Affinity Purified

Sign In for Pricing
View Details