Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD353 Recombinant Protein

Product Specifications

Background

SLAMF8, may play a role in B-lineage commitment and/or modulation of signaling through the B-cell receptor.

CAS Number

9000-83-3

Swiss Prot

Q9P0V8

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~25kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GCACAGGTGCTGAGTAAAGTTGGTGGTAGCGTTCTGCTGGTTGCAGCCCGCCCGCCGGGCTTCCAAGTGAGAGAAGCCATCTGGCGCAGCCTGTGGCCGAGCGAAGAACTGCTGGCAACCTTCTTCCGTGGCAGTCTGGAAACCTTATATCATAGTCGCTTCCTGGGCCGTGCCCAGCTGCATAGTAATCTGAGTCTGGAACTGGGCCCGCTGGAAAGCGGTGATAGCGGCAACTTCAGTGTGCTGATGGTTGATACCCGCGGCCAGCCGTGGACCCAGACCTTACAGCTGAAAGTGTATGATGCCGTGCCGCGCCCGGTGGTTCAGGTGTTCATTGCCGTGGAACGCGATGCCCAGCCGAGCAAAACCTGTCAGGTGTTCCTGAGCTGCTGGGCACCGAATATTAGCGAAATTACCTATAGCTGGCGTCGCGAAACCACCATGGACTTCGGTATGGAACCGCATAGTCTGTTCACCGATGGCCAGGTTCTGAGCATTAGTCTGGGTCCGGGTGATCGTGATGTGGCCTATAGTTGTATTGTTAGTAATCCGGTTAGCTGGGATCTGGCCACCGTTACCCCGTGGGATAGCTGTCATCATGAAGCAGCCCCGGGTAAAGCCAGTTATAAAGAT

Available Sizes

More Discoveries

Explore Other Products

Browse additional items from our catalog

Recombinant Bungarus candidus Phospholipase A2, beta bungarotoxin A1 chain
MBS1424319-01 0.02 mg (E-Coli)

Recombinant Bungarus candidus Phospholipase A2, beta bungarotoxin A1 chain

Sign In for Pricing
View Details
Recombinant Bungarus candidus Phospholipase A2, beta bungarotoxin A1 chain
MBS1424319-02 0.1 mg (E-Coli)

Recombinant Bungarus candidus Phospholipase A2, beta bungarotoxin A1 chain

Sign In for Pricing
View Details
Recombinant Bungarus candidus Phospholipase A2, beta bungarotoxin A1 chain
MBS1424319-03 0.02 mg (Yeast)

Recombinant Bungarus candidus Phospholipase A2, beta bungarotoxin A1 chain

Sign In for Pricing
View Details
Recombinant Bungarus candidus Phospholipase A2, beta bungarotoxin A1 chain
MBS1424319-04 0.1 mg (Yeast)

Recombinant Bungarus candidus Phospholipase A2, beta bungarotoxin A1 chain

Sign In for Pricing
View Details
Recombinant Bungarus candidus Phospholipase A2, beta bungarotoxin A1 chain
MBS1424319-05 0.02 mg (Baculovirus)

Recombinant Bungarus candidus Phospholipase A2, beta bungarotoxin A1 chain

Sign In for Pricing
View Details
Recombinant Bungarus candidus Phospholipase A2, beta bungarotoxin A1 chain
MBS1424319-06 1 mg (E-Coli)

Recombinant Bungarus candidus Phospholipase A2, beta bungarotoxin A1 chain

Sign In for Pricing
View Details