Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD352 Recombinant Protein

Product Specifications

Background

SLAMF6 (CD352/NTB-A) is a type-I transmembrane glycoprotein belonging to the signaling lymphocytic activation molecule (SLAM) family of immunomodulatory receptors. Like other members of the SLAM receptor family, SLAMF6 contains Ig-like domains within its extracellular region and conserved tyrosine-based signaling motifs within its intracellular domain that, when phosphorylated, bind to the SAP and EAT-2 signaling adaptors. SLAMF6 is expressed on the surface of multiple types of immune cells, such as those of the B, T, and NK lineages. Its activation is triggered by homotypic interactions involving its extracellular domain. Indeed, research studies have shown that in T-cells, SLAMF6 engagement facilitates activation and cytokine production. Similarly, homotypic ligand-mediated engagement of SLAMF6 on NK cells activates signaling cascades that drive proliferation, cytotoxicity, and cytokine production.

CAS Number

9000-83-3

Swiss Prot

Q96DU3

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~25kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

CAGAGTAGTCTGACCCCGCTGATGGTTAATGGTATTCTGGGCGAAAGTGTTACCCTGCCGCTGGAATTCCCGGCAGGCGAAAAAGTTAACTTCATTACCTGGCTGTTCAATGAAACCAGTCTGGCATTCATTGTTCCGCATGAAACCAAAAGTCCGGAAATTCATGTTACCAATCCGAAACAGGGCAAACGCCTGAACTTCACCCAGAGTTATAGCCTGCAGCTGAGTAATCTGAAAATGGAAGATACCGGTAGTTATCGTGCCCAGATTAGTACCAAAACCAGTGCAAAACTGAGCAGCTATACCCTGCGCATTCTGCGCCAGCTGCGTAATATTCAGGTGACCAATCATAGCCAGCTGTTCCAGAATATGACCTGTGAACTGCATCTGACCTGCAGCGTGGAAGATGCAGATGATAATGTGAGCTTCCGTTGGGAAGCCCTGGGCAATACCCTGAGCAGCCAGCCGAATCTGACCGTGAGCTGGGATCCGCGCATTAGTAGCGAACAGGATTATACCTGTATTGCAGAAAATGCAGTTAGTAATCTGAGCTTCAGCGTTAGTGCACAGAAACTGTGTGAAGATGTTAAAATTCAGTACACCGATACCAAAATG

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Recombinant Swine Mucin-2, N-His
AP9C944-01 1 mg

Recombinant Swine Mucin-2, N-His

Sign In for Pricing
View Details
Recombinant Swine Mucin-2, N-His
AP9C944-02 100 µg

Recombinant Swine Mucin-2, N-His

Sign In for Pricing
View Details
Recombinant Swine Mucin-2, N-His
AP9C944-03 200 µg

Recombinant Swine Mucin-2, N-His

Sign In for Pricing
View Details
Recombinant Swine Mucin-2, N-His
AP9C944-04 5 mg

Recombinant Swine Mucin-2, N-His

Sign In for Pricing
View Details
Recombinant Swine Mucin-2, N-His
AP9C944-05 50 µg

Recombinant Swine Mucin-2, N-His

Sign In for Pricing
View Details
Recombinant Swine Mucin-2, N-His
AP9C944-06 500 µg

Recombinant Swine Mucin-2, N-His

Sign In for Pricing
View Details