Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD349 Recombinant Protein

Product Specifications

Background

Receptor for WNT2 that is coupled to the beta-catenin canonical signaling pathway, which leads to the activation of disheveled proteins, inhibition of GSK-3 kinase, nuclear accumulation of beta-catenin and activation of Wnt target genes. Plays a role in neuromuscular junction (NMJ) assembly by negatively regulating the clustering of acetylcholine receptors (AChR) through the beta-catenin canonical signaling pathway. May play a role in neural progenitor cells (NPCs) viability through the beta-catenin canonical signaling pathway by negatively regulating cell cycle arrest leading to inhibition of neuron apoptotic process. During hippocampal development, regulates neuroblast proliferation and apoptotic cell death. Controls bone formation through non canonical Wnt signaling mediated via ISG15. Positively regulates bone regeneration through non canonical Wnt signaling (By similarity) .

CAS Number

9000-83-3

Swiss Prot

O00144

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~28kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

CTGGAAATTGGTCGCTTCGATCCGGAACGTGGCCGTGGTGCCGCCCCTTGTCAGGCAGTTGAAATTCCGATGTGCCGTGGTATTGGTTATAATCTGACCCGCATGCCGAATCTGCTGGGCCATACCAGTCAGGGCGAAGCAGCCGCCGAACTGGCAGAATTCGCCCCGCTGGTTCAGTATGGTTGCCATAGCCATCTGCGCTTCTTCCTGTGTAGCCTGTATGCCCCGATGTGCACCGATCAGGTTAGCACCCCGATTCCGGCATGTCGCCCGATGTGCGAACAGGCACGCCTGCGCTGTGCACCGATTATGGAACAGTTCAACTTCGGTTGGCCGGATAGTCTGGATTGTGCCCGCCTGCCGACCCGCAATGATCCGCATGCACTGTGCATGGAAGCACCGGAAAATGCCACCGCCGGCCCGGCTGAACCGCATAAAGGTCTGGGCATGCTGCCGGTGGCACCGCGTCCTGCACGTCCTCCTGGTGATCTGGGTCCGGGTGCAGGTGGTAGTGGCACCTGTGAAAATCCGGAAAAATTCCAGTATGTGGAAAAAAGCCGTAGCTGTGCACCGCGCTGCGGCCCTGGTGTGGAAGTGTTCTGGAGCCGCCGTGATAAAGAT

Available Sizes

More Discoveries

Explore Other Products

Browse additional items from our catalog

Xpnpep1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7109906 1.0 µg DNA

Xpnpep1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

Sign In for Pricing
View Details
Mink1 (BC052474) Mouse Tagged ORF Clone
MG211931 10 µg

Mink1 (BC052474) Mouse Tagged ORF Clone

Sign In for Pricing
View Details
Sheep BCL2/adenovirus E1B 19 kDa protein-interacting protein 3 ELISA Kit
MBS7278684-01 48 Well

Sheep BCL2/adenovirus E1B 19 kDa protein-interacting protein 3 ELISA Kit

Sign In for Pricing
View Details
Sheep BCL2/adenovirus E1B 19 kDa protein-interacting protein 3 ELISA Kit
MBS7278684-02 96 Well

Sheep BCL2/adenovirus E1B 19 kDa protein-interacting protein 3 ELISA Kit

Sign In for Pricing
View Details
Sheep BCL2/adenovirus E1B 19 kDa protein-interacting protein 3 ELISA Kit
MBS7278684-03 5x 96 Well

Sheep BCL2/adenovirus E1B 19 kDa protein-interacting protein 3 ELISA Kit

Sign In for Pricing
View Details
Sheep BCL2/adenovirus E1B 19 kDa protein-interacting protein 3 ELISA Kit
MBS7278684-04 10x 96 Well

Sheep BCL2/adenovirus E1B 19 kDa protein-interacting protein 3 ELISA Kit

Sign In for Pricing
View Details