CD344 Recombinant Protein

Frizzled-4 is a 537 amino acid protein encoded by the human gene FZD4. Frizzled-4 acts as a receptor for Wnt proteins. Most frizzled receptors are coupled to the b-catenin canonical signaling pathway, which leads to the activation of disheveled proteins, inhibition of GSK-3 kinase, nuclear accumulation of b-catenin and activation of Wnt target genes. A second signaling pathway involving PKC and calcium fluxes has been seen for some family members, but it is not yet clear if it represents a distinct pathway or if it can be integrated in the canonical pathway, as PKC seems to be required for Wnt-mediated inactivation of GSK-3 kinase. Both pathways seem to involve interactions with G-proteins. Frizzled-4 may be involved in transduction and intercellular transmission of polarity information during tissue morphogenesis and/or in differentiated tissues. Frizzled-4 also plays a critical role in retinal angiogenesis. Frizzled-4 is virtually ubiquitously expressed with greatest amounts found in adult heart, skeletal muscle, ovary, and fetal kidney

TTCGGCGATGAAGAAGAACGTCGCTGCGATCCGATTCGTATTAGTATGTGCCAGAATCTGGGTTATAATGTTACCAAAATGCCGAATCTGGTGGGCCATGAACTGCAGACCGATGCAGAACTGCAGCTGACCACCTTCACCCCGCTGATTCAGTATGGCTGTAGTAGTCAGCTGCAGTTCTTCCTGTGCAGTGTGTATGTGCCGATGTGCACCGAAAAAATTAATATTCCGATTGGTCCGTGTGGTGGCATGTGCCTGAGCGTGAAACGTCGTTGCGAACCGGTTCTGAAAGAATTCGGCTTCGCCTGGCCGGAAAGCCTGAATTGTAGTAAATTCCCGCCGCAGAATGATCATAATCACATGTGCATGGAAGGTCCGGGTGATGAAGAAGTTCCGCTGCCGCATAAAACACCTATTCAGCCGGGTGAAGAATGTCATAGTGTGGGCACCAATAGCGATCAGTATATCTGGGTTAAACGCAGTCTGAATTGCGTTCTGAAATGTGGTTATGATGCAGGCCTGTATAGC