Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD344 Recombinant Protein

Product Specifications

Background

Frizzled-4 is a 537 amino acid protein encoded by the human gene FZD4. Frizzled-4 acts as a receptor for Wnt proteins. Most frizzled receptors are coupled to the b-catenin canonical signaling pathway, which leads to the activation of disheveled proteins, inhibition of GSK-3 kinase, nuclear accumulation of b-catenin and activation of Wnt target genes. A second signaling pathway involving PKC and calcium fluxes has been seen for some family members, but it is not yet clear if it represents a distinct pathway or if it can be integrated in the canonical pathway, as PKC seems to be required for Wnt-mediated inactivation of GSK-3 kinase. Both pathways seem to involve interactions with G-proteins. Frizzled-4 may be involved in transduction and intercellular transmission of polarity information during tissue morphogenesis and/or in differentiated tissues. Frizzled-4 also plays a critical role in retinal angiogenesis. Frizzled-4 is virtually ubiquitously expressed with greatest amounts found in adult heart, skeletal muscle, ovary, and fetal kidney

CAS Number

9000-83-3

Swiss Prot

Q9ULV1

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~24kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

TTCGGCGATGAAGAAGAACGTCGCTGCGATCCGATTCGTATTAGTATGTGCCAGAATCTGGGTTATAATGTTACCAAAATGCCGAATCTGGTGGGCCATGAACTGCAGACCGATGCAGAACTGCAGCTGACCACCTTCACCCCGCTGATTCAGTATGGCTGTAGTAGTCAGCTGCAGTTCTTCCTGTGCAGTGTGTATGTGCCGATGTGCACCGAAAAAATTAATATTCCGATTGGTCCGTGTGGTGGCATGTGCCTGAGCGTGAAACGTCGTTGCGAACCGGTTCTGAAAGAATTCGGCTTCGCCTGGCCGGAAAGCCTGAATTGTAGTAAATTCCCGCCGCAGAATGATCATAATCACATGTGCATGGAAGGTCCGGGTGATGAAGAAGTTCCGCTGCCGCATAAAACACCTATTCAGCCGGGTGAAGAATGTCATAGTGTGGGCACCAATAGCGATCAGTATATCTGGGTTAAACGCAGTCTGAATTGCGTTCTGAAATGTGGTTATGATGCAGGCCTGTATAGC

Available Sizes

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

5- (2,5-Dioxo-pyrrolidin-1-yl) -naphthalene-1-sulfonyl chloride
sc-323325 1 g

5- (2,5-Dioxo-pyrrolidin-1-yl) -naphthalene-1-sulfonyl chloride

Ask
View Details
Recombinant Staphylococcus epidermidis D-alanine--poly (phosphoribitol) ligase subunit 1 (dltA)
MBS1364775-01 0.02 mg (E-Coli)

Recombinant Staphylococcus epidermidis D-alanine--poly (phosphoribitol) ligase subunit 1 (dltA)

Ask
View Details
Recombinant Staphylococcus epidermidis D-alanine--poly (phosphoribitol) ligase subunit 1 (dltA)
MBS1364775-02 0.02 mg (Yeast)

Recombinant Staphylococcus epidermidis D-alanine--poly (phosphoribitol) ligase subunit 1 (dltA)

Ask
View Details
Recombinant Staphylococcus epidermidis D-alanine--poly (phosphoribitol) ligase subunit 1 (dltA)
MBS1364775-03 0.1 mg (E-Coli)

Recombinant Staphylococcus epidermidis D-alanine--poly (phosphoribitol) ligase subunit 1 (dltA)

Ask
View Details
Recombinant Staphylococcus epidermidis D-alanine--poly (phosphoribitol) ligase subunit 1 (dltA)
MBS1364775-04 0.1 mg (Yeast)

Recombinant Staphylococcus epidermidis D-alanine--poly (phosphoribitol) ligase subunit 1 (dltA)

Ask
View Details
Recombinant Staphylococcus epidermidis D-alanine--poly (phosphoribitol) ligase subunit 1 (dltA)
MBS1364775-05 0.02 mg (Baculovirus)

Recombinant Staphylococcus epidermidis D-alanine--poly (phosphoribitol) ligase subunit 1 (dltA)

Ask
View Details