Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD337 Recombinant Protein

Product Specifications

Background

The immune response is the way the body recognizes and defends itself against microorganisms, viruses and substances recognized as foreign and potentially harmful to the body. Innate immunity is the barrier that keeps foreign materials from entering the body and represents the first line of defense in the immune response. During the innate response to many inflammatory and infectious stimuli, dendritic cells (DCs) undergo a differentiation process termed maturation. Mature DCs activate antigen-specific naive T cells and resting human natural killer (NK) cells. NK cell receptors NKp30, NKp44 and NKp46 appear to play prominent roles in NK cell activation. The human NKp30 gene maps to chromosome 6p21.3 and encodes a 190 amino acid protein. The NKp30 protein contains a signal peptide followed by a 120 amino acid extracellular region that forms a V-type Ig-like domain with 2 potential N-linked glycosylation sites, a hydrophobic transmembrane region with a positively charged Arginine residue, and a 33 amino acid cytoplasmic tail lacking an immunoreceptor tyrosine-based activating motif (ITAM) . NKp30 cooperates with NKp46 and/or NKp44 in the induction of NK-mediated cytotoxicity against the majority of target cells, where it represents the major triggering receptor in the killing of certain tumors.

CAS Number

9000-83-3

Swiss Prot

O14931

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~14kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

CTGTGGGTTAGCCAGCCGCCGGAAATTCGCACCCTGGAAGGCAGTAGTGCCTTCCTGCCGTGTAGCTTCAATGCAAGCCAGGGCCGCCTGGCCATTGGCAGTGTGACCTGGTTCCGTGATGAAGTTGTTCCGGGTAAAGAAGTTCGCAATGGTACCCCGGAATTCCGTGGCCGCCTGGCACCGCTGGCAAGTAGCCGCTTCCTGCATGATCATCAGGCAGAACTGCATATTCGTGATGTTCGTGGCCATGATGCAAGCATCTATGTGTGTCGCGTTGAAGTTCTGGGCCTGGGTGTTGGTACCGGTAATGGCACCCGCCTGGTTGTTGAAAAAGAACATCCGCAGCTGGGT

Available Sizes

More Discoveries

Explore Other Products

Browse additional items from our catalog

CD49D
552789 100 µg

CD49D

Sign In for Pricing
View Details
NKX6-1 (NKX6A, Homeobox Protein Nkx-6.1, Homeobox Protein NK-6 Homolog A) (APC)
130401-APC 100 µL

NKX6-1 (NKX6A, Homeobox Protein Nkx-6.1, Homeobox Protein NK-6 Homolog A) (APC)

Sign In for Pricing
View Details
Human GRAMD4 Pre-designed siRNA Set B
SI006605B 1 Each

Human GRAMD4 Pre-designed siRNA Set B

Sign In for Pricing
View Details
Mouse Monoclonal Haptoglobin Antibody (HP/3835) [DyLight 650]
NBP3-14067C 0.1 mL

Mouse Monoclonal Haptoglobin Antibody (HP/3835) [DyLight 650]

Sign In for Pricing
View Details
TMEM129 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV706667 1.0 µg DNA

TMEM129 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

Sign In for Pricing
View Details
Human hsa-miR-30a-3p miRNA Agomir
abx880027-01 5 nmol

Human hsa-miR-30a-3p miRNA Agomir

Sign In for Pricing
View Details