CD172g Recombinant Protein

SIRPs (signal-regulatory proteins) are a family of transmembrane glycoproteins that were identified by their association with the Src homology 2 domaincontaining protein-tyrosine phosphatase SHP-2 in response to Insulin. The SIRP family negatively regulates the PI 3-K pathway, which may diminish EGFR-mediated motility and survival phenotypes that contribute to transformation of certain cell types. SIRP-α1 is a transmembrane protein which contains an extracellular portion with three immunoglobulin-like structures and a cytoplasmic region with four potential tyrosine phosphorylation sites. SIRP-α1 is a substrate for activated receptor tyrosine kinases. In its tyrosine phosphorylated form, SIRP-α1 binds to SH-PTP2 through SH2 interactions and acts as an SH-PTP2 substrate. SIRP-α1 has been shown to have negative regulatory effects on cellular responses induced by growth factors, oncogenes and insulin. SIRP-β1 shares extensive sequence homology with SIRP-α1 in its extracellular portion but lacks the cytoplasmic portion. SIRP-γ, originally designated SIRP-β2 (SIRP-B2, CD172g) has unique characteristics from both the α and β versions. SIRP-γ is expressed on the majority of T cells and a proportion of B cells. CD47 associates with SIRP-γ, and this interaction signals unidirectionally only.

GAAGAAGAACTGCAGATGATTCAGCCGGAAAAACTGCTGCTGGTGACCGTGGGCAAAACCGCCACCCTGCATTGCACCGTGACCAGCCTGCTGCCGGTTGGCCCGGTGCTGTGGTTCCGCGGTGTTGGTCCGGGCCGCGAACTGATCTATAATCAGAAAGAAGGCCACTTCCCGCGTGTTACCACCGTGAGCGATCTGACCAAACGCAATAATATGGACTTCAGCATTCGCATTAGCAGCATTACCCCGGCAGATGTTGGTACCTATTATTGCGTGAAATTCCGTAAAGGCAGTCCGGAAAATGTGGAATTCAAAAGTGGCCCGGGTACCGAAATGGCACTGGGCGCCAAACCGAGCGCCCCGGTTGTTCTGGGTCCGGCAGCCCGTACCACCCCGGAACATACCGTTAGCTTCACCTGCGAAAGCCATGGCTTCAGCCCGCGCGATATTACCCTGAAATGGTTCAAAAATGGTAATGAACTGAGCGACTTCCAGACCAATGTTGATCCGACCGGCCAGAGCGTGGCATATAGCATTCGCAGTACCGCCCGCGTTGTTCTGGATCCGTGGGATGTTCGTAGTCAGGTTATCTGTGAAGTGGCCCATGTGACCCTGCAGGGTGATCCGCTGCGCGGTACCGCAAATCTGAGTGAAGCCATTCGTGTGCCGCCGACCCTGGAAGTTACCCAGCAGCCGATGCGTGTGGGCAATCAGGTTAATGTGACCTGTCAGGTGCGCAAATTCTATCCGCAGAGTCTGCAGCTGACCTGGAGCGAAAATGGCAATGTGTGTCAGCGTGAAACCGCAAGTACCCTGACCGAAAATAAAGATGGCACCTATAATTGGACCAGCTGGTTCCTGGTTAATATTAGCGATCAGCGTGATGATGTGGTGCTGACCTGTCAGGTTAAACATGATGGCCAGCTGGCCGTGAGTAAACGTCTGGCCCTGGAAGTTACAGTGCATCAGAAAGATCAGAGCAGCGATGCCACCCCG