Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD172a Recombinant Protein

Product Specifications

Background

SHP-substrate 1 (SHPS1, SIRPα) is a single-pass membrane protein and member of both the immunoglobulin superfamily and the signal regulatory protein (SIRP) family. Following growth hormone stimulation or integrin binding, SHPS1 is phosphorylated at several tyrosine residues within its cytoplasmic tail. These phosphorylation events promote association between SHPS1 and multiple signaling proteins, including SHP-1, SHP-2, Grb2 and Shc via their SH2 domains. Recruitment of SHP-1 and SHP-2 results in SHPS1 dephosphorylation and suppression of tyrosine kinase signaling. The tyrosine kinase JAK2 associates with SHPS1 via its carboxy terminus and phosphorylates SHPS1 in response to extracellular stimuli. Research studies show that Src associates with and may phosphorylate SHPS1 in response to insulin. In macrophages, SHPS1 can form a complex with the Src pathway adaptor protein SKAP2, Fyn-binding protein FYB, and the tyrosine kinase PYK2. The SHPS1 extracellular domain contains at least three IgG-like domains that interact with CD47, a ubiquitously expressed, integrin-associated protein that acts as a repressive cue in both immune and neuronal cells. The interaction between CD47 and SHPS1 on opposing cells can inhibit cellular migration, promote "tethering" between macrophages and target cells during engulfment, facilitate self versus non-self recognition, and maintain immune homeostasis (12) . SHPS1 plays a critical role in modulating the immune response and inflammation, and may play a role in neuronal development. The interaction between SHPS1 and CD47 may be an exploitable target in cancer therapy.

CAS Number

9000-83-3

Swiss Prot

P78324

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~38kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GAAGAAGAACTGCAGGTGATTCAGCCGGATAAAAGCGTTCTGGTTGCAGCAGGTGAAACCGCAACCCTGCGCTGTACCGCCACCAGCCTGATTCCGGTTGGTCCGATTCAGTGGTTCCGCGGCGCAGGTCCGGGCAGAGAACTGATCTATAATCAGAAAGAAGGTCACTTCCCGCGCGTTACCACCGTTAGTGATCTGACCAAACGTAATAATATGGACTTCAGTATTCGCATTGGTAATATTACCCCGGCAGATGCAGGTACCTATTATTGCGTGAAATTCCGTAAAGGTAGTCCGGATGATGTTGAATTCAAAAGCGGCGCAGGCACCGAACTGAGTGTGCGCGCCAAACCGAGTGCCCCGGTTGTTAGTGGCCCGGCAGCCCGTGCCACCCCTCAACATACCGTTAGCTTCACCTGTGAAAGCCATGGCTTCAGTCCGCGTGATATTACCCTGAAATGGTTCAAAAATGGTAATGAACTGAGCGACTTCCAGACCAATGTTGATCCGGTTGGTGAAAGTGTTAGCTATAGTATTCATAGCACCGCAAAAGTGGTTCTGACCCGCGAAGATGTTCATAGCCAGGTTATCTGTGAAGTGGCACATGTTACCCTGCAGGGTGATCCGCTGCGCGGTACCGCAAATCTGAGCGAAACCATTCGCGTTCCGCCGACCCTGGAAGTGACCCAGCAGCCGGTTCGTGCCGAAAATCAGGTTAATGTTACCTGCCAGGTTCGCAAATTCTATCCGCAGCGTCTGCAGCTGACCTGGCTGGAAAATGGTAATGTTAGTCGCACCGAAACCGCAAGTACCGTTACCGAAAATAAAGATGGTACCTATAATTGGATGAGTTGGCTGCTGGTGAATGTGAGTGCCCATCGCGATGATGTGAAACTGACCTGCCAGGTGGAACATGATGGTCAGCCGGCAGTGAGCAAAAGCCATGATCTGAAAGTTAGTGCCCATCCGAAAGAACAGGGTAGTAATACCGCCGCAGAAAATACCGGCAGCAATGAACGTAATATCTAT

Available Sizes

More Discoveries

Explore Other Products

Browse additional items from our catalog

Porcine ANGPT1 ELISA Kit (Ready to Use)
orb554304-01 48 Tests

Porcine ANGPT1 ELISA Kit (Ready to Use)

Sign In for Pricing
View Details
Porcine ANGPT1 ELISA Kit (Ready to Use)
orb554304-02 96 Tests

Porcine ANGPT1 ELISA Kit (Ready to Use)

Sign In for Pricing
View Details
RPS6P19 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV782529 1.0 µg DNA

RPS6P19 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

Sign In for Pricing
View Details
Rabbit anti-Helios Antibody, Affinity Purified
MBS3903878-01 0.01 mg

Rabbit anti-Helios Antibody, Affinity Purified

Sign In for Pricing
View Details
Rabbit anti-Helios Antibody, Affinity Purified
MBS3903878-02 0.1 mg

Rabbit anti-Helios Antibody, Affinity Purified

Sign In for Pricing
View Details
Rabbit anti-Helios Antibody, Affinity Purified
MBS3903878-03 5x 0.01 mg

Rabbit anti-Helios Antibody, Affinity Purified

Sign In for Pricing
View Details