Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD164 Recombinant Protein

Product Specifications

Background

CD164 is a mucin-like cell surface glycoprotein that facilitates adhesion of CD34+ cells and serves as a negative regulator of hematopoietic progenitor cell proliferation. Human CD164 in CD34+CD38+ hematopoietic progenitor and epithelial cell lines localizes to endosomes and lysosomes, with low concentrations also appearing at the cell surface.

CAS Number

9000-83-3

Swiss Prot

Q04900

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~24kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GATAAGAACACCACCCAGCATCCGAATGTGACCACCCTGGCACCGATTAGTAATGTTACCAGTGCACCGGTGACCAGTCTGCCGCTGGTTACCACCCCGGCACCGGAAACCTGTGAAGGTCGTAATAGTTGTGTTAGCTGCTTCAATGTGAGCGTGGTGAATACCACCTGCTTCTGGATTGAATGCAAAGATGAAAGCTATTGTAGCCATAATAGCACCGTTAGCGATTGCCAGGTGGGCAATACCACCGACTTCTGTAGTGTTAGTACCGCCACCCCGGTTCCGACCGCAAATAGCACCGCCAAACCGACCGTGCAGCCGAGTCCGAGCACCACCAGCAAAACCGTTACCACCAGCGGCACCACCAATAATACCGTGACCCCGACCAGTCAGCCGGTTCGTAAAAGCACCTTCGAT

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

PE/Cy7 Anti-human/monkey CD20 Antibody *2H7*
102021M0-AAT 25 Tests

PE/Cy7 Anti-human/monkey CD20 Antibody *2H7*

Sign In for Pricing
View Details
Adra1a 3'UTR GFP Stable Cell Line
TU151463 1.0 mL

Adra1a 3'UTR GFP Stable Cell Line

Sign In for Pricing
View Details
PHKG2 Human Over-expression Lysate
orb1379318 20 µg

PHKG2 Human Over-expression Lysate

Sign In for Pricing
View Details
Anti-PCTAIRE1/CDK16 Antibody Picoband®, Dylight550 Conjugate
A06102-1-Dylight550 100 µg

Anti-PCTAIRE1/CDK16 Antibody Picoband®, Dylight550 Conjugate

Sign In for Pricing
View Details
KRT13, NT (Keratin, Type I Cytoskeletal 13, Cytokeratin-13, CK-13, Keratin-13, K13) (MaxLight 750) discontinued
K0199-16D-ML750 100 µL

KRT13, NT (Keratin, Type I Cytoskeletal 13, Cytokeratin-13, CK-13, Keratin-13, K13) (MaxLight 750) discontinued

Sign In for Pricing
View Details
RXFP3 discontinued
394043-01 20 µL

RXFP3 discontinued

Sign In for Pricing
View Details