CD164 Recombinant Protein
Product Specifications
Background
CD164 is a mucin-like cell surface glycoprotein that facilitates adhesion of CD34+ cells and serves as a negative regulator of hematopoietic progenitor cell proliferation. Human CD164 in CD34+CD38+ hematopoietic progenitor and epithelial cell lines localizes to endosomes and lysosomes, with low concentrations also appearing at the cell surface.
CAS Number
9000-83-3
Swiss Prot
Q04900
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~24kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
GATAAGAACACCACCCAGCATCCGAATGTGACCACCCTGGCACCGATTAGTAATGTTACCAGTGCACCGGTGACCAGTCTGCCGCTGGTTACCACCCCGGCACCGGAAACCTGTGAAGGTCGTAATAGTTGTGTTAGCTGCTTCAATGTGAGCGTGGTGAATACCACCTGCTTCTGGATTGAATGCAAAGATGAAAGCTATTGTAGCCATAATAGCACCGTTAGCGATTGCCAGGTGGGCAATACCACCGACTTCTGTAGTGTTAGTACCGCCACCCCGGTTCCGACCGCAAATAGCACCGCCAAACCGACCGTGCAGCCGAGTCCGAGCACCACCAGCAAAACCGTTACCACCAGCGGCACCACCAATAATACCGTGACCCCGACCAGTCAGCCGGTTCGTAAAAGCACCTTCGAT
Available Sizes
Frequently Asked Questions
More Discoveries
Explore Other Products
Browse additional items from our catalog
MBS9335194-01 48 Well
Rat Regulating synaptic membrane exocytosis protein 2, RIMS2 ELISA Kit
Sign In for Pricing
View Details MBS9335194-02 96 Well
Rat Regulating synaptic membrane exocytosis protein 2, RIMS2 ELISA Kit
Sign In for Pricing
View Details MBS9335194-03 5x 96 Well
Rat Regulating synaptic membrane exocytosis protein 2, RIMS2 ELISA Kit
Sign In for Pricing
View Details MBS9335194-04 10x 96 Well
Rat Regulating synaptic membrane exocytosis protein 2, RIMS2 ELISA Kit
Sign In for Pricing
View Details MBS9913831-01 48 Well
Porcine NLR Family Member X1 (NLRX1) ELISA Kit
Sign In for Pricing
View Details MBS9913831-02 96 Well
Porcine NLR Family Member X1 (NLRX1) ELISA Kit
Sign In for Pricing
View Details